Mature miRNA: hsa-miR-377-5p



Mature miRNA

miRNA Name hsa-miR-377-5p
Previous Name hsa-miR-377*
miRNA Sequence 5' - agagguugcccuuggugaauuc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004689
Similar miRNAs hsa-miR-6086 (sharing the same seed sequence with hsa-miR-377-5p).

Precursor miRNA

Precursor Name hsa-mir-377
Genomic Location chr14:101062050-101062118 (+); nearby genomic features
Clustered miRNAs hsa-mir-487a,hsa-mir-382,hsa-mir-134,hsa-mir-668,hsa-mir-485,hsa-mir-323b,hsa-mir-154,hsa-mir-496,hsa-mir-377,hsa-mir-541,hsa-mir-409,hsa-mir-412,hsa-mir-369,hsa-mir-410,hsa-mir-656 (within 10kb in genome)
NCBI GENE ID 494326
miRBase ID MI0000785
Precursor Sequence
uu              c   -    a    - uuu
  gagcagagguugcc uug guga uucg c   a
  |||||||||||||| ||| |||| |||| |    u
  uuuguuuucaacgg aac cacu aagu g   u
-g              a   a    -    u uau

References


  • The predictive value of miR-377 and phospholipase A2 in the early diagnosis of diabetic kidney disease and their relationship with inflammatory factors. Xing C, Huo L, Tang H, Lu Y, Liu G, Chen F, Hou Z. Immunobiology. 2024 Mar;229(2):152792.

  • MicroRNA-377-3p exacerbates chronic obstructive pulmonary disease through suppressing ZFP36L1 expression and inducing lung fibroblast senescence. Lu F, Yao LP, Gao DD, Alinejad T, Jiang XQ, Wu Q, Zhai QC, Liu M, Zhu SM, Qian MX, Xu LF, Chen CS, Zhang F. Respir Res. 2024 Feb 5;25(1):67.

  • Mechanisms by which silencing long-stranded noncoding RNA KCNQ1OT1 alleviates myocardial ischemia/reperfusion injury (MI/RI)-induced cardiac injury via miR-377-3p/HMOX1. Tan T, Tu L, Yu Y, He M, Zhou X, Yang L. BMC Cardiovasc Disord. 2024 Jan 3;24(1):19.

  • The Role of Cystathionine-β-Synthase, H Liu CY, Al-Ward H, Liu N, Mekontso FN, Chen W, Gao W, Zhang C, Murshed A, Yu ZR, Fan O, Sun YE, Xu H. J Mol Neurosci. 2023 Dec;73(11-12):921-931.

  • Bioinformatics analysis illustrates the functions of miR-377-5p in cervical cancer. Wang D, Zhang Y, Ren D, Meng C, Yang L. Biotechnol Genet Eng Rev. 2024 Dec;40(4):4238-4249.

  • Circ_0058063 regulates the development of esophageal cancer through miR-377-3p/HOXA1 axis. Chen L, Luo C, Xu Y, Hu J, Chen H. Anticancer Drugs. 2023 Apr 1;34(4):495-506.

  • CircRNA Circ_0000118 Regulates Malignancy of Cervical Cancer Cells by Regulating miR-211-5p/miR-377-3p/AKT2 Axis. Wu L, Xiao H, Hong Y, Xie M, Yu Y, Jiang L. Biochem Genet. 2023 Aug;61(4):1625-1644.

  • LncRNA NEAT1 regulates the growth, migration, and invasion of the human esophageal cancer cells via the miR-377/E2F3 axis. Du W, Xu P, Yin H. Acta Biochim Pol. 2022 Oct 17;69(4):731-736.

  • ceRNA network of lncRNA MIR210HG/miR-377-3p/LMX1A in malignant proliferation of glioma cells. Yu Z, Che N, He Y, Zhang B. Genes Genomics. 2022 Dec;44(12):1445-1455.

  • SESN1, negatively regulated by miR-377-3p, suppresses invasive growth of head and neck squamous cell carcinoma by interaction with SMAD3. Zhang C, Ren L, Zhang H, Yang S, Deng M, He L, Cao R, Zhao C, Xia J. Hum Cell. 2022 Jul;35(4):1100-1113.

  • Novel microRNA biomarkers of systemic lupus erythematosus in plasma: miR-124-3p and miR-377-3p. Yan L, Jiang L, Wang B, Hu Q, Deng S, Huang J, Sun X, Zhang Y, Feng L, Chen W. Clin Biochem. 2022 Sep;107:55-61.

  • MicroRNA-377-3p promotes cell proliferation and inhibits cell cycle arrest and cell apoptosis in hepatocellular carcinoma by affecting EGR1-mediated p53 activation. Li W, Li K, Wang Z, Fa Z. Pathol Res Pract. 2022 Jun;234:153855.

  • Circular RNA circKIF2A Contributes to the Progression of Neuroblastoma Through Regulating PRPS1 Expression by Sponging miR-377-3p. Jin Q, Li J, Yang F, Feng L, Du X. Biochem Genet. 2022 Aug;60(4):1380-1401.

  • Knockdown of lncRNA NEAT1 suppresses proliferation and migration, and induces apoptosis of cervical cancer cells by regulating the miR‑377/FGFR1 axis. Geng F, Jia WC, Li T, Li N, Wei W. Mol Med Rep. 2022 Jan;25(1):10.

  • The role of miRNA-377 as a tumor suppressor in lung cancer by negative regulation of genes belonging to ErbB signaling pathway. Hashemi S, Yari N, Rahimi Jamnani F, Mahdian R, Karimi M, Zeinali S, Rafiee MH, Azizi M. Mol Biol Rep. 2022 Jan;49(1):85-95.

  • Complex Conformational Dynamics of the Heart Failure-Associated Pre-miRNA-377 Hairpin Revealed by Single-Molecule Optical Tweezers. Wypijewska Del Nogal A, Sundar Rajan V, Westerlund F, Wilhelmsson LM. Int J Mol Sci. 2021 Aug 20;22(16):9008.

  • microRNA-377-3p inhibits osteosarcoma progression by targeting CUL1 and regulating Wnt/β-catenin signaling pathway. Liang K, Liao L, Liu Q, Ouyang Q, Jia L, Wu G. Clin Transl Oncol. 2021 Nov;23(11):2350-2357.

  • Association between long noncoding RNA taurine-upregulated gene 1 and microRNA-377 in vitiligo. Alhelf M, Rashed LA, Ragab N, Elmasry MF. Int J Dermatol. 2022 Feb;61(2):199-207.

  • Serum exosomal miR-377-3p inhibits retinal pigment epithelium proliferation and offers a biomarker for diabetic macular edema. Jiang L, Cao H, Deng T, Yang M, Meng T, Yang H, Luo X. J Int Med Res. 2021 Apr;49(4):3000605211002975.

  • microRNA-377-3p downregulates the oncosuppressor T-cadherin in colorectal adenocarcinoma cells. Di Palo A, Siniscalchi C, Polito R, Nigro E, Russo A, Daniele A, Potenza N. Cell Biol Int. 2021 Aug;45(8):1797-1803.


  • There are 81 references associated with hsa-miR-377-5p. Click here to see the complete list in PubMed.