Mature miRNA: hsa-miR-376b-3p

Mature miRNA

miRNA Name hsa-miR-376b-3p
Previous Name hsa-miR-376b
miRNA Sequence 5' - aucauagaggaaaauccauguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002172
Similar miRNAs hsa-miR-376a-3p (sharing the same seed sequence with hsa-miR-376b-3p).

Precursor miRNA

Precursor Name hsa-mir-376b
Genomic Location chr14:101040436-101040535 (+); nearby genomic features
Clustered miRNAs hsa-mir-543,hsa-mir-495,hsa-mir-376c,hsa-mir-376a-2,hsa-mir-654,hsa-mir-376b,hsa-mir-376a-1,hsa-mir-300,hsa-mir-1185-1,hsa-mir-1185-2,hsa-mir-381,hsa-mir-487b,hsa-mir-539,hsa-mir-889,hsa-mir-544a,hsa-mir-655 (within 10kb in genome)
NCBI GENE ID 574435
MIM ID 610961
miRBase ID MI0002466
Precursor Sequence 
    ccuuc         u           a     u     uuuacg    u
cagu     uuugguauu aaaacguggau uuccu cuaug      ugau c
||||     ||||||||| ||||||||||| ||||| |||||      ||||  c
gucg     aaacuauga uuuuguaccua aagga gauac      auug u
    ----u         c           a     -     ----ua    g

References

  • LINC01980 induced by TGF-beta promotes hepatocellular carcinoma metastasis via miR-376b-5p/E2F5 axis. Sheng J, Luo Y, Lv E, Liang H, Tao H, Yu C, Rao D, Sun M, Xia L, Huang W. Cell Signal. 2023 Dec;112:110923.

  • MicroRNA-376b is involved in the pathogenesis of thyroid-associated ophthalmopathy by regulating HAS2. Liu R, Ye Z, Liu Q, Xuan M, Li R, Zhang L, Zhang K, Fang P, Xue Y. Endocrine. 2023 Oct;82(1):87-95.

  • Long noncoding RNA MAPKAPK5-AS1 promotes metastasis through regulation miR-376b-5p/ECT2 axis in hepatocellular carcinoma. Lv E, Sheng J, Yu C, Rao D, Huang W. Dig Liver Dis. 2023 Jul;55(7):945-954.

  • MiR-376b-3p functions as a tumor suppressor by targeting KLF15 in non-small cell lung cancer. Liu XW, Zhang CC, Zhang T. Eur Rev Med Pharmacol Sci. 2020 Sep;24(18):9480-9486.

  • [Study on the expression of non-coding microRNA-376b-3p in serum exosomes of patients with malignant glioma and the mechanism of anti-angiogenesis]. Jiang J, Wang S, Meng QH, Yu R, Wei SC, Wang J, Qu CC, Wang CW. Zhonghua Yi Xue Za Zhi. 2020 Jun 2;100(21):1634-1639.

  • LncRNA NEAT1 regulated cell proliferation, invasion, migration and apoptosis by targeting has-miR-376b-3p/SULF1 axis in non-small cell lung cancer. Chen LM, Niu YD, Xiao M, Li XJ, Lin H. Eur Rev Med Pharmacol Sci. 2020 May;24(9):4810-4821.

  • miR-376b-5p regulates angiogenesis in cerebral ischemia. Li LJ, Huang Q, Zhang N, Wang GB, Liu YH. Mol Med Rep. 2014 Jul;10(1):527-35.

  • Differential microRNA expression in peripheral blood mononuclear cells from Graves' disease patients. Liu R, Ma X, Xu L, Wang D, Jiang X, Zhu W, Cui B, Ning G, Lin D, Wang S. J Clin Endocrinol Metab. 2012 Jun;97(6):E968-72.

  • Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs. Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F. RNA. 2012 Mar;18(3):472-84.

  • miR-376b controls starvation and mTOR inhibition-related autophagy by targeting ATG4C and BECN1. Korkmaz G, le Sage C, Tekirdag KA, Agami R, Gozuacik D. Autophagy. 2012 Feb 1;8(2):165-76.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Redirection of silencing targets by adenosine-to-inosine editing of miRNAs. Kawahara Y, Zinshteyn B, Sethupathy P, Iizasa H, Hatzigeorgiou AG, Nishikura K. Science. 2007 Feb 23;315(5815):1137-40.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Clustering and conservation patterns of human microRNAs. Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H. Nucleic Acids Res. 2005 May 12;33(8):2697-706.