Mature miRNA: hsa-miR-301a-3p



Mature miRNA

miRNA Name hsa-miR-301a-3p
Previous Name hsa-miR-301;hsa-miR-301a
miRNA Sequence 5' - cagugcaauaguauugucaaagc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000688
Similar miRNAs hsa-miR-130a-3p, hsa-miR-130b-3p, hsa-miR-301b-3p, hsa-miR-3666, hsa-miR-4295, hsa-miR-454-3p (sharing the same seed sequence with hsa-miR-301a-3p).

Precursor miRNA

Precursor Name hsa-mir-301a
Genomic Location chr17:59151136-59151221 (-); nearby genomic features
NCBI GENE ID 407027
MIM ID 615675
miRBase ID MI0000745
Precursor Sequence
a     aa  a     c    ---u          ----a     
 cugcu  cg augcu ugac    uuauugcacu     cuguac
 |||||  || ||||| ||||    ||||||||||     ||||| u
 gacga  gu uacga acug    gauaacguga     gacauu
g     aa  c     a    uuau          cgauc     

References


  • miRNA-301 As a molecule promoting necrotizing enterocolitis by inducing inflammation. Zou D, Hu F, Zhou Q, Xu X. Acta Biochim Pol. 2023 Nov 28;70(4):905-910.

  • IRE1-mediated degradation of pre-miR-301a promotes apoptosis through upregulation of GADD45A. Gebert M, Bartoszewska S, Opalinski L, Collawn JF, Bartoszewski R. Cell Commun Signal. 2023 Nov 9;21(1):322.

  • [MiR-301a-5p modulates parathyroid hormone secretion in secondary hyperparathyroidism possibly by regulating calcium-sensing receptor]. Liu L, Qian L, Li P, Li J, Huang S, Yi W, Liu S, Wu W. Nan Fang Yi Ke Da Xue Xue Bao. 2023 Aug 20;43(8):1363-1370.

  • Hsa-miR-301a-3p inhibited the killing effect of natural killer cells on non-small cell lung cancer cells by regulating RUNX3. Zhang J, Yang Y, Wei Y, Li L, Wang X, Ye Z. Cancer Biomark. 2023;37(4):249-259.

  • Identification of Key Genes and miRNAs Affecting Osteosarcoma Based on Bioinformatics. Li L, Zhou X, Zhang W, Zhao R. Dis Markers. 2022 Nov 16;2022:1015593.

  • microRNA-301a-3p is a potential biomarker in venous ulcers vein and gets involved in endothelial cell dysfunction. Wang Y, Du J, Liu Y, Yang S, Wang Q. Bioengineered. 2022 Jun;13(6):14138-14158.

  • circ_0008797 attenuates non-small cell lung cancer proliferation, metastasis, and aerobic glycolysis by sponging miR-301a-3p/SOCS2. Abuduwaili K, Zhu X, Shen Y, Lu S, Liu C. Environ Toxicol. 2022 Jul;37(7):1697-1710.

  • MiR-301a-3p Advances IRAK1-Mediated Differentiation of Th17 Cells to Promote the Progression of Systemic Lupus Erythematosus via Targeting PELI1. Luo S, Wu R, Li Q, Zhang G. J Healthc Eng. 2021 Dec 11;2021:2982924.

  • Methylation and expression levels of microRNA-23b/-24-1/-27b, microRNA-30c-1/-30e, microRNA-301a and let-7g are dysregulated in clear cell renal cell carcinoma. Gilyazova I, Ivanova E, Gilyazova G, Sultanov I, Izmailov A, Safiullin R, Pavlov V, Khusnutdinova E. Mol Biol Rep. 2021 Jul;48(7):5561-5569.

  • Exosomal microRNA-301a-3p promotes the proliferation and invasion of nasopharyngeal carcinoma cells by targeting BTG1 mRNA. Cheng Q, Li Q, Xu L, Jiang H. Mol Med Rep. 2021 May;23(5):328.

  • MicroRNA-301a Promotes Cell Proliferation and Resistance to Apoptosis through PTEN/PI3K/Akt Signaling Pathway in Human Ovarian Cancer. Ni J, Chen Y, Fei B, Zhu Y, Du Y, Liu L, Guo L, Zhu W. Gynecol Obstet Invest. 2021;86(1-2):108-116.

  • MicroRNA‑301a/ZNRF3/wnt/β‑catenin signal regulatory crosstalk mediates glioma progression. Sun J, Ma Q, Shu C, Xiong J, Li B, Wu J, Zhang S, Li J, Liu J, Wang J. Int J Oncol. 2021 Jan;58(1):45-56.

  • Potential biomarkers in NASH-induced liver cirrhosis with hepatocellular carcinoma: A preliminary work on roles of exosomal miR-182, miR-301a, and miR-373. Muhammad Yusuf AN, Raja Ali RA, Muhammad Nawawi KN, Mokhtar NM. Malays J Pathol. 2020 Dec;42(3):377-384.

  • Diagnostic molecular markers predicting aggressive potential in low-grade prostate cancer. Saran U, Chandrasekaran B, Kolluru V, Tyagi A, Nguyen KD, Valadon CL, Shaheen SP, Kong M, Poddar T, Ankem MK, Damodaran C. Transl Res. 2021 May;231:92-101.

  • MicroRNA-301a inhibits the progression of osteosarcoma by regulating DEC2. Wu H, Yu Z, Chen Q, Li D, Chen W. J BUON. 2020 Mar-Apr;25(2):1013-1021.

  • Cdc42-Dependent Transfer of mir301 from Breast Cancer-Derived Extracellular Vesicles Regulates the Matrix Modulating Ability of Astrocytes at the Blood-Brain Barrier. Morad G, Daisy CC, Otu HH, Libermann TA, Dillon ST, Moses MA. Int J Mol Sci. 2020 May 28;21(11):3851.

  • MiR-301a transcriptionally activated by HIF-2α promotes hypoxia-induced epithelial-mesenchymal transition by targeting TP63 in pancreatic cancer. Zhang KD, Hu B, Cen G, Yang YH, Chen WW, Guo ZY, Wang XF, Zhao Q, Qiu ZJ. World J Gastroenterol. 2020 May 21;26(19):2349-2373.

  • Upregulation of miRNA‑301a‑3p promotes tumor progression in gastric cancer by suppressing NKRF and activating NF‑κB signaling. Xu X, Xia Y, Ma J, Li W, Niu N, Li X, Tao H, Xu J, He X. Int J Oncol. 2020 Aug;57(2):522-532.

  • MicroRNA-301a (miR-301a) is induced in hepatocellular carcinoma (HCC) and down- regulates the expression of interferon regulatory factor-1. Dong K, Du Q, Cui X, Wan P, Kaltenmeier C, Luo J, Yan B, Yan Y, Geller DA. Biochem Biophys Res Commun. 2020 Apr 2;524(2):273-279.

  • MicroRNA‑301a‑3p overexpression promotes cell invasion and proliferation by targeting runt‑related transcription factor 3 in prostate cancer. Fan L, Wang Y, Huo W, Wang WH. Mol Med Rep. 2019 Oct;20(4):3755-3763.


  • There are 83 references associated with hsa-miR-301a-3p. Click here to see the complete list in PubMed.