Mature miRNA: hsa-miR-130b-3p

Mature miRNA

miRNA Name hsa-miR-130b-3p
Previous Name hsa-miR-130b
miRNA Sequence 5' - cagugcaaugaugaaagggcau - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000691
Similar miRNAs hsa-miR-130a-3p, hsa-miR-301a-3p, hsa-miR-301b-3p, hsa-miR-3666, hsa-miR-4295, hsa-miR-454-3p (sharing the same seed sequence with hsa-miR-130b-3p).

Precursor miRNA

Precursor Name hsa-mir-130b
Genomic Location chr22:21653304-21653385 (+); nearby genomic features
Clustered miRNAs hsa-mir-301b,hsa-mir-130b (within 10kb in genome)
NCBI GENE ID 406920
MIM ID 613682
miRBase ID MI0000748
Precursor Sequence 
      c    ca       cc         a  --a   g
ggccug ccga  cucuuuc  uguugcacu cu   uag c
|||||| ||||  |||||||  ||||||||| ||   ||| 
cuggac ggcu  gggaaag  guaacguga ga   guc c
      u    ac       ua         c  agg   g

References

  • LncRNA BRCAT54 is downregulated and inhibits cancer cell proliferation by downregulating miR-130b-3p through methylation in prostate cancer. Liang H, Lu Y, Huang X, Ye T. J Biochem Mol Toxicol. 2024 Jan;38(1):e23552.

  • Impaired angiogenesis in diabetic critical limb ischemia is mediated by a miR-130b/INHBA signaling axis. Cheng HS, Pérez-Cremades D, Zhuang R, Jamaiyar A, Wu W, Chen J, Tzani A, Stone L, Plutzky J, Ryan TE, Goodney PP, Creager MA, Sabatine MS, Bonaca MP, Feinberg MW. JCI Insight. 2023 May 22;8(10):e163041.

  • MiR-130b modulates the invasive, migratory, and metastatic behavior of leiomyosarcoma. Danielson LS, Guijarro MV, Menendez S, Higgins B, Sun Q, Mittal K, Popiolek DA, Overholtzer M, Palmer GD, Hernando E. PLoS One. 2023 Jan 26;18(1):e0278844.

  • STAT3/miR-130b-3p/MBNL1 feedback loop regulated by mTORC1 signaling promotes angiogenesis and tumor growth. Li H, Liu P, Li D, Wang Z, Ding Z, Zhou M, Chen X, Miao M, Ding J, Lin W, Liu Y, Zha X. J Exp Clin Cancer Res. 2022 Oct 11;41(1):297.

  • Hsa-let-7c-5p, hsa-miR-130b-3p, and hsa-miR-142-3p as Novel miRNA Biomarkers for Melanoma Progression. Wu X, Wang Y, Chen C, Xue Y, Zheng S, Cai L. Genet Res (Camb). 2022 Jul 7;2022:5671562.

  • Human placenta mesenchymal stem cell-derived exosome shuttling microRNA-130b-3p from gestational diabetes mellitus patients targets ICAM-1 and perturbs human umbilical vein endothelial cell angiogenesis. Gao Z, Wang N, Liu X. Acta Diabetol. 2022 Aug;59(8):1091-1107.

  • Expression Profiles of Exosomal MicroRNAs Derived from Cerebrospinal Fluid in Patients with Congenital Hydrocephalus Determined by MicroRNA Sequencing. Chen S, Li H, Zheng J, Hao L, Jing T, Wu P, Zhang B, Ma D, Zhang J, Ma J. Dis Markers. 2022 Mar 4;2022:5344508.

  • Long non-coding RNA MRPS30 divergent transcript can be detected in the cytoplasm of triple-negative breast cancer cells and is targeted by microRNA-130b. Wang D, Song Q, Zhao T, Wang F, Yu Y, Qi J, Lyu P, Duan X. Bioengineered. 2022 Mar;13(3):5954-5961.

  • Synovial mesenchymal stem cell-derived extracellular vesicles alleviate chondrocyte damage during osteoarthritis through microRNA-130b-3p-mediated inhibition of the LRP12/AKT/β-catenin axis. Zeng Z, Dai Y, Deng S, Zou S, Dou T, Wei F. Immunopharmacol Immunotoxicol. 2022 Apr;44(2):247-260.

  • MiR-130b-3p promotes colorectal cancer progression by targeting CHD9. Song D, Zhang Q, Zhang H, Zhan L, Sun X. Cell Cycle. 2022 Mar-Mar;21(6):585-601.

  • Dihydroartemisinin inhibits IL-6-induced epithelial-mesenchymal transition in laryngeal squamous cell carcinoma via the miR-130b-3p/STAT3/β-catenin signaling pathway. Sun Y, Lu X, Li H, Li X. J Int Med Res. 2021 Nov;49(11):3000605211009494.

  • Levels of miR-130b-5p in peripheral blood are associated with severity of coronary artery disease. Coban N, Ozuynuk AS, Erkan AF, Guclu-Geyik F, Ekici B. Mol Biol Rep. 2021 Dec;48(12):7719-7732.

  • Adipose expression of miR-130b and miR-17-5p with wasting, cardiovascular event and mortality in advanced chronic kidney disease patients. Chan GC, Than WH, Kwan BC, Lai KB, Chan RC, Ng JK, Chow KM, Cheng PM, Law MC, Leung CB, Li PK, Szeto CC. Nephrol Dial Transplant. 2022 Sep 22;37(10):1935-1943.

  • miR-130b and miR-128a are essential lineage-specific codrivers of t(4;11) MLL-AF4 acute leukemia. Malouf C, Antunes ETB, O'Dwyer M, Jakobczyk H, Sahm F, Landua SL, Anderson RA, Soufi A, Halsey C, Ottersbach K. Blood. 2021 Nov 25;138(21):2066-2092.

  • miR-130b inhibits proliferation and promotes differentiation in myocytes via targeting Sp1. Wang YC, Yao X, Ma M, Zhang H, Wang H, Zhao L, Liu S, Sun C, Li P, Wu Y, Li X, Jiang J, Li Y, Li Y, Ying H. J Mol Cell Biol. 2021 Sep 11;13(6):422-432.

  • miR-130b-3p is high-expressed in polycystic ovarian syndrome and promotes granulosa cell proliferation by targeting SMAD4. Bao D, Li M, Zhou D, Zhuang C, Ge Z, Wei Q, Zhang L. J Steroid Biochem Mol Biol. 2021 May;209:105844.

  • MicroRNA-130b inhibits cerebral ischemia/reperfusion induced cell apoptosis via regulation of IRF1. Liu ZD, Wang Q, Pan DQ, Meng FQ, Li JT, Wang YH. Eur Rev Med Pharmacol Sci. 2020 Dec;24(23):12334-12341.

  • Bone marrow mesenchymal stem cells derived miRNA-130b enhances epithelial sodium channel by targeting PTEN. Zhang H, Ding Y, Hou Y, Liu Y, Zhou Z, Nie H. Respir Res. 2020 Dec 11;21(1):329.

  • Molecular mechanism underlying miR‑130b‑Sp1 transcriptional regulation in LPS‑induced upregulation of MUC5AC in the bile duct epithelium. Wu X, Yao C, Kong J, Tian Y, Fan Y, Zhang Z, Han J, Wu S. Mol Med Rep. 2021 Feb;23(2):106.

  • Elevated microRNA-130b-5p or silenced ELK1 inhibits self-renewal ability, proliferation, migration, and invasion abilities, and promotes apoptosis of cervical cancer stem cells. Huang Y, Luo F. IUBMB Life. 2021 Jan;73(1):118-129.

    • There are 110 references associated with hsa-miR-130b-3p. Click here to see the complete list in PubMed.