Mature miRNA: hsa-miR-23a-3p

Mature miRNA

miRNA Name hsa-miR-23a-3p
Previous Name hsa-miR-23a
miRNA Sequence 5' - aucacauugccagggauuucc - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000078
Similar miRNAs hsa-miR-23b-3p, hsa-miR-23c (sharing the same seed sequence with hsa-miR-23a-3p).

Precursor miRNA

Precursor Name hsa-mir-23a
Genomic Location chr19:13836587-13836659 (-); nearby genomic features
Clustered miRNAs hsa-mir-24-2,hsa-mir-27a,hsa-mir-23a (within 10kb in genome)
NCBI GENE ID 407010
MIM ID 607962
miRBase ID MI0000079
Precursor Sequence 
  c   c     -       g    g      cuuc
gg cgg ugggg uuccugg gaug gauuug    c
|| ||| ||||| ||||||| |||| ||||||    
cc gcc accuu agggacc uuac cuaaac    u
  a   a     u       g    a      acug

References

  • LINC00472 suppresses non-small cell lung cancer progression via regulating miR-23a-3p/CCL22 axis. Yang S, Liu Y, Li Y, Ji X, Yun Y, Yang G, Liu H, Liang X, Dang H. Cell Mol Biol (Noisy-le-grand). 2024 Jun 5;70(6):54-60.

  • MiR-23a-5p alleviates chronic obstructive pulmonary disease through targeted regulation of RAGE-ROS pathway. Chang C, Huang K, Xu X, Duan R, Yu T, Chu X, Chen C, Li B, Yang T. Respir Res. 2024 Feb 20;25(1):93.

  • Human papillomavirus type 16 E7 promotes cell viability and migration in cervical cancer by regulating the miR-23a/HOXC8 axis. Chen Y, Sun L, Li L. J Obstet Gynaecol. 2024 Dec;44(1):2311658.

  • Exosomal miR-23a-3p derived from human umbilical cord mesenchymal stem cells promotes remyelination in central nervous system demyelinating diseases by targeting Tbr1/Wnt pathway. Qin D, Wang C, Li D, Guo S. J Biol Chem. 2024 Jan;300(1):105487.

  • MicroRNA-23a-3p Is Upregulated in Plasma Exosomes of Bulbar-onset ALS Patients and Targets ERBB4. Liu Y, Ding M, Pan S, Zhou R, Yao J, Fu R, Yu H, Lu Z. Neuroscience. 2023 Aug 1;524:65-78.

  • Role of circ-FOXO3 and miR-23a in radiosensitivity of breast cancer. Abdollahi E, Mozdarani H, Alizadeh BZ. Breast Cancer. 2023 Sep;30(5):714-726.

  • TFAP2C inhibits cell autophagy to alleviate myocardial ischemia/reperfusion injury by regulating miR-23a-5p/SFRP5/Wnt5a axis. Zeng M, Wei X, He YL, Chen JX, Lin WT. FASEB J. 2023 Jun;37(6):e22959.

  • The Role of microRNA-23a-3p in the Progression of Human Aging Process by Targeting FOXO3a. Wang S, Sun Y, Yao L, Xing Y, Yang H, Ma Q. Mol Biotechnol. 2024 Feb;66(2):277-287.

  • Circular RNA hsa_circ_0007444 inhibits ovarian cancer progression through miR-23a-3p/DICER1 axis. Zhang M, Sun Y, Xu H, Shi Y, Shen R, Teng F, Xu J, Jia X. Acta Biochim Biophys Sin (Shanghai). 2023 Apr 13;55(4):574-586.

  • MicroRNA-23a-3p overexpression represses proliferation and accelerates apoptosis of granular cells in polycystic ovarian syndrome by targeting HMGA2. Wei J, Cheng P, Kong M, Zhang L, Liu S, Ning B, Huang X. Gynecol Endocrinol. 2023 Dec;39(1):2172155.

  • miR-23a-3p and miR-181a-5p modulate SNAP-25 expression. Agostini S, Bolognesi E, Mancuso R, Marventano I, Citterio LA, Guerini FR, Clerici M. PLoS One. 2023 Jan 17;18(1):e0279961.

  • miR-23a-3p promotes the development of colon cancer by inhibiting the expression of NDRG4. Zuo H, Liu S, Li X, Hou G. Clin Transl Oncol. 2023 Apr;25(4):933-940.

  • Down-Regulation of circulating miR-23a-3p, miR-101-3p, and miR-let-7c in Women with Idiopathic Recurrent Pregnancy Loss. Tutunfroush M, Ghorbian S, Mohseni J, Danaii S, Rad MG. Clin Lab. 2022 Oct 1;68(10).

  • Focusing on OB-OC-MΦ Axis and miR-23a to Explore the Pathogenesis and Treatment Strategy of Osteoporosis. Ma TL, Zhu P, Ke ZR, Chen JX, Hu YH, Xie J. Front Endocrinol (Lausanne). 2022 Jul 14;13:891313.

  • Long non-coding RNA growth arrest specific 5 regulates the T helper 17/regulatory T balance by targeting miR-23a in myasthenia gravis. Xu Y, Ouyang Y. J Int Med Res. 2022 Jun;50(6):3000605211053703.

  • The molecular mechanism of circRHOBTB3 inhibits the proliferation and invasion of epithelial ovarian cancer by serving as the ceRNA of miR-23a-3p. Fu Y, Sun H. J Ovarian Res. 2022 Jun 1;15(1):66.

  • MicroRNA-23a-3p ameliorates acute kidney injury by targeting FKBP5 and NF-κB signaling in sepsis. Xu H, Wang Z. Cytokine. 2022 Jul;155:155898.

  • miR-23a-3p inhibits sepsis-induced kidney epithelial cell injury by suppressing Wnt/β-catenin signaling by targeting wnt5a. Ye J, Feng H, Peng Z. Braz J Med Biol Res. 2022 Feb 28;55:e11571.

  • Translation regulatory long non-coding RNA 1 (TRERNA1) sponges microRNA-23a to suppress granulosa cell apoptosis in premature ovarian failure. Zhang L, Mao B, Zhao X, Yuan Y, Wang W, Lin S. Bioengineered. 2022 Feb;13(2):2173-2180.

  • Exosome miR-23a-3p from Osteoblast Alleviates Spinal Cord Ischemia/Reperfusion Injury by Down-Regulating KLF3-Activated CCNL2 Transcription. Wu C, Zhu Q, Yao Y, Shi Z, Jin C, Chen L. Dev Neurosci. 2022;44(3):121-130.

    • There are 196 references associated with hsa-miR-23a-3p. Click here to see the complete list in PubMed.