Mature miRNA: hsa-miR-6751-3p

Mature miRNA

miRNA Name hsa-miR-6751-3p
miRNA Sequence 5' - acugagccucucucucuccag - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0027403
Similar miRNAs hsa-miR-1199-5p (sharing the same seed sequence with hsa-miR-6751-3p).

Precursor miRNA

Precursor Name hsa-mir-6751
Genomic Location chr11:65129916-65129978 (-); nearby genomic features
NCBI GENE ID 102465449
miRBase ID MI0022596
Precursor Sequence 
ucuucuu     u      g u      c cc
       ggggg gagguu g gucugg c  a
       ||||| |||||| | |||||| |  
       cucuc cuccga u cagacc g  g
--gaccu     u      g -      c ac

References

  • Cisplatin resistance and malignant behaviors of lung cancer cells are promoted by circ_0002360 via targeting miR-6751-3p to regulate the expression of ZNF300. Ding L, Li L, Tang Z. Thorac Cancer. 2022 Apr;13(7):986-996.

  • Triptolide antagonized the cisplatin resistance in human ovarian cancer cell line A2780/CP70 via hsa-mir-6751. Wang R, Ma X, Su S, Liu Y. Future Med Chem. 2018 Aug 1;10(16):1947-1955.

  • Discovery of hundreds of mirtrons in mouse and human small RNA data. Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC. Genome Res. 2012 Sep;22(9):1634-45.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.