Mature miRNA: hsa-miR-1199-5p

Mature miRNA

miRNA Name hsa-miR-1199-5p
miRNA Sequence 5' - ccugagcccgggccgcgcag - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0031119
Similar miRNAs hsa-miR-6751-3p (sharing the same seed sequence with hsa-miR-1199-5p).

Precursor miRNA

Precursor Name hsa-mir-1199
Genomic Location chr19:14073361-14073479 (+); nearby genomic features
NCBI GENE ID 102466515
miRBase ID MI0020340
Precursor Sequence 
---  cc     c     -       u ag     gccgcgcaggccgugaacucgucgagcugcgcgugcggcc   g
   ag  ugcgc ggagc cggggcc g  cccgg                                        ggu c
   ||  ||||| ||||| ||||||| |  |||||                                        |||  u
   uc  gcgcg ccucg gccccgg c  gggcc                                        cca c
agg  cc     c     c       u cu     --------------------------------------gu   a

References

  • MicroR-1199-5p targeting SRD5A2 promotes the biological behavior and EMT of hypospadias cells. Chen Y, Hu J, Peng L, Zhao Y. Cell Mol Biol (Noisy-le-grand). 2024 Jun 5;70(6):122-128.

  • Upregulation of mir-1199-5p is associated with reduced type 2 5-α reductase expression in benign prostatic hyperplasia. Liu Z, Lin Z, Cao F, Jiang M, Jin S, Cui Y, Niu YN. BMC Urol. 2022 Nov 7;22(1):172.

  • Human hepatocellular carcinoma cell-specific miRNAs reveal the differential expression of miR-24 and miR-27a in cirrhotic/non-cirrhotic HCC. Salvi A, Abeni E, Portolani N, Barlati S, De Petro G. Int J Oncol. 2013 Feb;42(2):391-402.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.