Precursor miRNA: mmu-mir-702

Precursor miRNA

Precursor Name mmu-mir-702
Genomic Location chr5:136991433-136991541 (+); nearby genomic features
NCBI GENE ID 735283
miRBase ID MI0004686
Precursor Sequence 
cgggacaaggu           uu  ca     -   ccau  -    -  --  c     g
           gaguggggugg  gg  ugggu ugc    gg ggac uc  ga gcugu c
           |||||||||||  ||  ||||| |||    || |||| ||  || ||||| 
           cucgccccauu  cc  acccg acg    cc ccug ag  cu cgaca c
----------c           uc  --     u   cacu  u    u  uc  c     c

Mature miRNA

Mature Name mmu-miR-702-5p
Mature Sequence 5' - gugaguggggugguuggcaug - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0022931
Similar miRNAs mmu-miR-3102-5p (sharing the same seed sequence with mmu-miR-702-5p).

References

  • MiR-702-5p ameliorates diabetic encephalopathy in db/db mice by regulating 12/15-LOX. Tu Y, Chen Q, Guo W, Xiang P, Huang H, Fei H, Chen L, Yang Y, Peng Z, Gu C, Tan X, Liu X, Lu Y, Chen R, Wang H, Luo Y, Yang J. Exp Neurol. 2022 Dec;358:114212.

  • Mmu-miR-702 functions as an anti-apoptotic mirtron by mediating ATF6 inhibition in mice. Zhang WG, Chen L, Dong Q, He J, Zhao HD, Li FL, Li H. Gene. 2013 Dec 1;531(2):235-42.

  • Non-canonical microRNAs miR-320 and miR-702 promote proliferation in Dgcr8-deficient embryonic stem cells. Kim BM, Choi MY. Biochem Biophys Res Commun. 2012 Sep 21;426(2):183-9.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. Babiarz JE, Ruby JG, Wang Y, Bartel DP, Blelloch R. Genes Dev. 2008 Oct 15;22(20):2773-85.

  • Unintentional miRNA ablation is a risk factor in gene knockout studies: a short report. Osokine I, Hsu R, Loeb GB, McManus MT. PLoS Genet. 2008 Feb;4(2):e34.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.