Precursor miRNA: mmu-mir-688

Precursor miRNA

Precursor Name mmu-mir-688
Genomic Location chr15:102671792-102671866 (-); nearby genomic features
NCBI GENE ID 751542
miRBase ID MI0004653
Precursor Sequence 
gaaa    -   gaa   -      gg      uu    ag
    gggc agu   gaa aaguag  gcuugc  gggg  a
    |||| |||   ||| ||||||  ||||||  ||||  
    cccg ucg   cuu uucauc  cggacg  cucc  g
----    c   -ac   a      ag      --    ac

Mature miRNA

Mature Name mmu-miR-688
Mature Sequence 5' - ucgcaggcgacuacuuauuc - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003467

References

  • A resource for the conditional ablation of microRNAs in the mouse. Park CY, Jeker LT, Carver-Moore K, Oh A, Liu HJ, Cameron R, Richards H, Li Z, Adler D, Yoshinaga Y, Martinez M, Nefadov M, Abbas AK, Weiss A, Lanier LL, de Jong PJ, Bluestone JA, Srivastava D, McManus MT. Cell Rep. 2012 Apr 19;1(4):385-91.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.