Precursor miRNA: mmu-mir-361

Precursor miRNA

Precursor Name mmu-mir-361
Genomic Location chrX:113074824-113074893 (-); nearby genomic features
NCBI GENE ID 723850
miRBase ID MI0000761
Precursor Sequence 
     uu         --u  a    u    agua
gaagc  aucagaauc   cc gggg acuu    u
|||||  |||||||||   || |||| ||||    
cuuug  uagucuuag   gg cccc ugaa    u
     uu         ugu  a    c    aagu

Mature miRNA

Mature Name mmu-miR-361-5p
Previous Name mmu-miR-361
Mature Sequence 5' - uuaucagaaucuccagggguac - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000704

Mature miRNA

Mature Name mmu-miR-361-3p
Previous Name mmu-miR-361*
Mature Sequence 5' - ucccccaggugugauucugauuugu - 3' (length = 25)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0017075

References

  • Silencing of maternally expressed RNAs in Dlk1-Dio3 domain causes fatal vascular injury in the fetal liver. Yu H, Zhao Y, Cheng R, Wang M, Hu X, Zhang X, Teng X, He H, Han Z, Han X, Wang Z, Liu B, Zhang Y, Wu Q. Cell Mol Life Sci. 2024 Oct 9;81(1):429.

  • MiR-361-3p alleviates cerebral ischemia-reperfusion injury by targeting NACC1 through the PINK1/Parkin pathway. Ye X, Song H, Hu H, Zhou C, Chen Q, Hong L, Huang M, Zhu H. J Mol Histol. 2022 Apr;53(2):357-367.

  • MicroRNA-361 suppresses the biological processes of hepatic stellate cells in HBV-relative hepatic fibrosis by NF-kappaB p65. Yu G, Mu H, Zhou H, Fang F, Cui Y, Wu Q, Xiong Q, Li H. Cells Dev. 2021 Sep;167:203711.

  • MicroRNA-361 regulates apoptosis of cardiomyocytes after ischemic-reperfusion injury. Xie Y, Yao FL, Li X. Eur Rev Med Pharmacol Sci. 2019 Jun;23(12):5413-5421.

  • Obesity-induced upregulation of miR-361-5p promotes hepatosteatosis through targeting Sirt1. Zhang Z, Liu X, Xu H, Feng X, Lin Y, Huang Y, Peng Y, Gu M. Metabolism. 2018 Nov;88:31-39.

  • Regulation of nonylphenol-induced reproductive toxicity in mouse spermatogonia cells by miR-361-3p. Tang L, Zhao B, Zhang H, Du Q, Zhu J, Zhao Z, Chen C, Luo C, Kang Q, Yuan W, Bian S, Bi H, Sun H, Li Y. Mol Reprod Dev. 2017 Dec;84(12):1257-1270.

  • miR-361-regulated prohibitin inhibits mitochondrial fission and apoptosis and protects heart from ischemia injury. Wang K, Liu CY, Zhang XJ, Feng C, Zhou LY, Zhao Y, Li PF. Cell Death Differ. 2015 Jun;22(6):1058-68.

  • MDRL lncRNA regulates the processing of miR-484 primary transcript by targeting miR-361. Wang K, Sun T, Li N, Wang Y, Wang JX, Zhou LY, Long B, Liu CY, Liu F, Li PF. PLoS Genet. 2014 Jul 24;10(7):e1004467.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2. Polikepahad S, Corry DB. Nucleic Acids Res. 2013 Jan;41(2):1164-77.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. Zhu JY, Strehle M, Frohn A, Kremmer E, Höfig KP, Meister G, Adler H. J Virol. 2010 Oct;84(19):10266-75.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Unintentional miRNA ablation is a risk factor in gene knockout studies: a short report. Osokine I, Hsu R, Loeb GB, McManus MT. PLoS Genet. 2008 Feb;4(2):e34.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Maternal microRNAs are essential for mouse zygotic development. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Genes Dev. 2007 Mar 15;21(6):644-8.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • A pancreatic islet-specific microRNA regulates insulin secretion. Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M. Nature. 2004 Nov 11;432(7014):226-30.