Precursor miRNA: mmu-mir-30c-2

Precursor miRNA

Precursor Name mmu-mir-30c-2
Genomic Location chr1:23291701-23291784 (+); nearby genomic features
NCBI GENE ID 723964
miRBase ID MI0000548
Precursor Sequence 
   u a    uauu       u   aca         gugaaa
gag g caga    guaaaca ccu   cucucagcu      a
||| | ||||    ||||||| |||   |||||||||      
uuc c gucu    cauuugu gga   gagggucga      g
   - -    cucu       c   --a         aagaau

Mature miRNA

Mature Name mmu-miR-30c-5p
Previous Name mmu-miR-30c
Mature Sequence 5' - uguaaacauccuacacucucagc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000514
Similar miRNAs mmu-miR-30a-5p, mmu-miR-30b-5p, mmu-miR-30d-5p, mmu-miR-30e-5p, mmu-miR-384-5p (sharing the same seed sequence with mmu-miR-30c-5p).

References

  • MiR-30c-5p-Targeted Regulation of GNAI2 Improves Neural Function Injury and Inflammation in Cerebral Ischemia-Reperfusion Injury. Deng X, Zeng Y, Ding D. Appl Biochem Biotechnol. 2024 Aug;196(8):5235-5248.

  • The role of microRNA-30c in targeting interleukin 6, as an inflammatory cytokine, in the mesenchymal stem cell: a therapeutic approach in colorectal cancer. Mahjoor M, Afkhami H, Najafi M, Nasr A, Khorrami S. J Cancer Res Clin Oncol. 2023 Jul;149(7):3149-3160.

  • MicroRNA-30c-2-3p represses malignant progression of gastric adenocarcinoma cells via targeting ARHGAP11A. Zheng L, Cai X, Song J, Shi H, Zhang J, Ke X, Li H, Chen Y. Bioengineered. 2022 Jun;13(6):14534-14544.

  • miR-324-5p and miR-30c-2-3p Alter Renal Mineralocorticoid Receptor Signaling under Hypertonicity. Vu TA, Lema I, Hani I, Cheval L, Atger-Lallier L, Souvannarath V, Perrot J, Souvanheuane M, Marie Y, Fabrega S, Blanchard A, Bouligand J, Kamenická»· P, Crambert G, Martinerie L, Lombès M, Viengchareun S. Cells. 2022 Apr 19;11(9):1377.

  • MiR-30c/PGC-1β protects against diabetic cardiomyopathy via PPARα. Yin Z, Zhao Y, He M, Li H, Fan J, Nie X, Yan M, Chen C, Wang DW. Cardiovasc Diabetol. 2019 Jan 11;18(1):7.

  • Lin28a overexpression reveals the role of Erk signaling in articular cartilage development. Kobayashi T, Kozlova A. Development. 2018 Aug 2;145(15):dev162594.

  • lncRNA Liang T, Zhou B, Shi L, Wang H, Chu Q, Xu F, Li Y, Chen R, Shen C, Schinckel AP. FASEB J. 2018 Jan;32(1):377-389.

  • MicroRNA-Dependent Control of Serotonin-Induced Pulmonary Arterial Contraction. Dahan D, Hien TT, Tannenberg P, Ekman M, Rippe C, Boettger T, Braun T, Tran-Lundmark K, Tran PK, Swärd K, Albinsson S. J Vasc Res. 2017;54(4):246-256.

  • MiR-30c protects diabetic nephropathy by suppressing epithelial-to-mesenchymal transition in db/db mice. Zhao Y, Yin Z, Li H, Fan J, Yang S, Chen C, Wang DW. Aging Cell. 2017 Apr;16(2):387-400.

  • MiR-30c-5p ameliorates hepatic steatosis in leptin receptor-deficient (db/db) mice via down-regulating FASN. Fan J, Li H, Nie X, Yin Z, Zhao Y, Chen C, Wen Wang D. Oncotarget. 2017 Feb 21;8(8):13450-13463.

  • MicroRNA-30 inhibits antiapoptotic factor Mcl-1 in mouse and human hematopoietic cells after radiation exposure. Li XH, Ha CT, Xiao M. Apoptosis. 2016 Jun;21(6):708-20.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • miR-30 family microRNAs regulate myogenic differentiation and provide negative feedback on the microRNA pathway. Guess MG, Barthel KK, Harrison BC, Leinwand LA. PLoS One. 2015 Feb 17;10(2):e0118229.

  • miR-30 promotes thermogenesis and the development of beige fat by targeting RIP140. Hu F, Wang M, Xiao T, Yin B, He L, Meng W, Dong M, Liu F. Diabetes. 2015 Jun;64(6):2056-68.

  • Cardiomyocyte-specific miRNA-30c over-expression causes dilated cardiomyopathy. Wijnen WJ, van der Made I, van den Oever S, Hiller M, de Boer BA, Picavet DI, Chatzispyrou IA, Houtkooper RH, Tijsen AJ, Hagoort J, van Veen H, Everts V, Ruijter JM, Pinto YM, Creemers EE. PLoS One. 2014 May 2;9(5):e96290.

  • Profiling circulating microRNA expression in experimental sepsis using cecal ligation and puncture. Wu SC, Yang JC, Rau CS, Chen YC, Lu TH, Lin MW, Tzeng SL, Wu YC, Wu CJ, Hsieh CH. PLoS One. 2013 Oct 30;8(10):e77936.

  • Identification of an imprinted gene cluster in the X-inactivation center. Kobayashi S, Totoki Y, Soma M, Matsumoto K, Fujihara Y, Toyoda A, Sakaki Y, Okabe M, Ishino F. PLoS One. 2013 Aug 6;8(8):e71222.

  • Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2. Polikepahad S, Corry DB. Nucleic Acids Res. 2013 Jan;41(2):1164-77.

  • Isolation of fetal gonads from embryos of timed-pregnant mice for morphological and molecular studies. Li Y, Taketo T, Lau YF. Methods Mol Biol. 2012;825:3-16.

  • Two microRNAs, miR-330 and miR-125b-5p, mark the juxtaglomerular cell and balance its smooth muscle phenotype. Medrano S, Monteagudo MC, Sequeira-Lopez ML, Pentz ES, Gomez RA. Am J Physiol Renal Physiol. 2012 Jan 1;302(1):F29-37.

    • There are 38 references associated with mmu-mir-30c-2. Click here to see the complete list in PubMed.