Precursor miRNA: mmu-mir-107

Precursor miRNA

Precursor Name mmu-mir-107
Genomic Location chr19:34820687-34820773 (-); nearby genomic features
NCBI GENE ID 723826
miRBase ID MI0000684
Precursor Sequence 
-             --c    u  u           c   u   a
 uucucugugcuuu   agcu cu uacaguguugc uug ggc u
 |||||||||||||   |||| || ||||||||||| ||| |||  g
 gagagacacgaaa   ucgg ga auguuacgacg aac uug g
c             cua    -  c           -   -   a

Mature miRNA

Mature Name mmu-miR-107-3p
Previous Name mmu-miR-107
Mature Sequence 5' - agcagcauuguacagggcuauca - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000647
Similar miRNAs mmu-miR-103-3p (sharing the same seed sequence with mmu-miR-107-3p).

References

  • miR-107-5p ameliorates neurological damage, oxidative stress, and immune responses in mice with Alzheimer's disease by suppressing the Toll-like receptor 4 (TLR4)/nuclear factor-kappaB(NF-κB) pathway. Hu GJ, Jiang XY, Du SY, Zhang K, Chen Z. Kaohsiung J Med Sci. 2024 Feb;40(2):119-130.

  • The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL, Amendt BA. Stem Cells. 2021 Jun;39(6):761-775.

  • Exosomal miR-107 antagonizes profibrotic phenotypes of pericytes by targeting a pathway involving HIF-1 Wang YC, Xie H, Zhang YC, Meng QH, Xiong MM, Jia MW, Peng F, Tang DL. Am J Physiol Heart Circ Physiol. 2021 Feb 1;320(2):H520-H534.

  • P53/PANK1/miR-107 signalling pathway spans the gap between metabolic reprogramming and insulin resistance induced by high-fat diet. Yang L, Zhang B, Wang X, Liu Z, Li J, Zhang S, Gu X, Jia M, Guo H, Feng N, Fan R, Xie M, Pei J, Chen L. J Cell Mol Med. 2020 Mar;24(6):3611-3624.

  • LncRNA RMST-mediated miR-107 transcription promotes OGD-induced neuronal apoptosis via interacting with hnRNPK. Cheng H, Sun M, Wang ZL, Wu Q, Yao J, Ren G, Sun XL. Neurochem Int. 2020 Feb;133:104644.

  • microRNA-107 protects against inflammation and endoplasmic reticulum stress of vascular endothelial cells via KRT1-dependent Notch signaling pathway in a mouse model of coronary atherosclerosis. Gao ZF, Ji XL, Gu J, Wang XY, Ding L, Zhang H. J Cell Physiol. 2019 Jul;234(7):12029-12041.

  • Down-Regulation of Mir-107 Worsen Spatial Memory by Suppressing SYK Expression and Inactivating NF-ΚB Signaling Pathway. Hu W, Wen L, Cao F, Wang Y. Curr Alzheimer Res. 2019;16(2):135-145.

  • Central Dicer-miR-103/107 controls developmental switch of POMC progenitors into NPY neurons and impacts glucose homeostasis. Croizier S, Park S, Maillard J, Bouret SG. Elife. 2018 Oct 12;7:e40429.

  • MicroRNA-107 prevents amyloid-β-induced neurotoxicity and memory impairment in mice. Shu B, Zhang X, Du G, Fu Q, Huang L. Int J Mol Med. 2018 Mar;41(3):1665-1672.

  • Inhibition of mitochondrial β-oxidation by miR-107 promotes hepatic lipid accumulation and impairs glucose tolerance in vivo. Bhatia H, Pattnaik BR, Datta M. Int J Obes (Lond). 2016 May;40(5):861-9.

  • microRNA-103/107 Family Regulates Multiple Epithelial Stem Cell Characteristics. Peng H, Park JK, Katsnelson J, Kaplan N, Yang W, Getsios S, Lavker RM. Stem Cells. 2015 May;33(5):1642-56.

  • Downregulation of microRNA-107 in intestinal CD11c(+) myeloid cells in response to microbiota and proinflammatory cytokines increases IL-23p19 expression. Xue X, Cao AT, Cao X, Yao S, Carlsen ED, Soong L, Liu CG, Liu X, Liu Z, Duck LW, Elson CO, Cong Y. Eur J Immunol. 2014 Mar;44(3):673-82.

  • Spatial and temporal expression levels of specific microRNAs in a spinal cord injury mouse model and their relationship to the duration of compression. Ziu M, Fletcher L, Savage JG, Jimenez DF, Digicaylioglu M, Bartanusz V. Spine J. 2014 Feb 1;14(2):353-60.

  • Profiling circulating microRNA expression in experimental sepsis using cecal ligation and puncture. Wu SC, Yang JC, Rau CS, Chen YC, Lu TH, Lin MW, Tzeng SL, Wu YC, Wu CJ, Hsieh CH. PLoS One. 2013 Oct 30;8(10):e77936.

  • Identification of an imprinted gene cluster in the X-inactivation center. Kobayashi S, Totoki Y, Soma M, Matsumoto K, Fujihara Y, Toyoda A, Sakaki Y, Okabe M, Ishino F. PLoS One. 2013 Aug 6;8(8):e71222.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Vascular endothelial growth factor-dependent spinogenesis underlies antidepressant-like effects of enriched environment. Huang YF, Yang CH, Huang CC, Hsu KS. J Biol Chem. 2012 Nov 30;287(49):40938-55.

  • miR-107 promotes tumor progression by targeting the let-7 microRNA in mice and humans. Chen PS, Su JL, Cha ST, Tarn WY, Wang MY, Hsu HC, Lin MT, Chu CY, Hua KT, Chen CN, Kuo TC, Chang KJ, Hsiao M, Chang YW, Chen JS, Yang PC, Kuo ML. J Clin Invest. 2011 Sep;121(9):3442-55.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • MicroRNAs 103 and 107 regulate insulin sensitivity. Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, Heim MH, Stoffel M. Nature. 2011 Jun 8;474(7353):649-53.

    • There are 44 references associated with mmu-mir-107. Click here to see the complete list in PubMed.