Precursor miRNA: hsa-mir-761

Precursor miRNA

Precursor Name hsa-mir-761
Genomic Location chr1:51836344-51836402 (-); nearby genomic features
NCBI GENE ID 100313892
miRBase ID MI0003941
Precursor Sequence 
                      g  a  g
ggaggagcagcagggugaaacu ac ca u
|||||||||||||||||||||| || || 
ccuccucgucguuucacuuuga ug gu u
                      g  -  c

Mature miRNA

Mature Name hsa-miR-761
Mature Sequence 5' - gcagcagggugaaacugacaca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0010364
Similar miRNAs hsa-miR-214-3p, hsa-miR-3619-5p (sharing the same seed sequence with hsa-miR-761).

References

  • The circular RNA circSLC16A10 alleviates diabetic retinopathy by improving mitochondrial function via the miR-761-5p/MFN2 axis. Lu L, Ning Y, Gu F, Lin Z, Qin Y, Feng L, Tang M, Cao Y. Cell Signal. 2024 Sep;121:111283.

  • Regulation of a Novel CircTRRAP/miR-761/MAP3K2 CeRNA Cascade in Inflammation, Apoptosis, and Oxidative Stress in Human AC16 Cardiomyocytes under Hypoxia Conditions. Xu W, Qian L, Yuan X, Lu Y. Int Heart J. 2023;64(3):442-452.

  • circRNA-MSR regulates the expression of FBXO21 to inhibit chondrocyte autophagy by targeting miR-761 in osteoarthritis. Jia Z, Liu J, Wang J. Kaohsiung J Med Sci. 2022 Dec;38(12):1168-1177.

  • Circ_0061140 Contributes to Ovarian Cancer Progression by Targeting miR-761/LETM1 Signaling. Ma L, Liu W, Li M. Biochem Genet. 2023 Apr;61(2):628-650.

  • Exosomal lncRNA HOTAIR Promotes the Progression and Angiogenesis of Endometriosis via the miR-761/HDAC1 Axis and Activation of STAT3-Mediated Inflammation. Zhang L, Yu Z, Qu Q, Li X, Lu X, Zhang H. Int J Nanomedicine. 2022 Mar 16;17:1155-1170.

  • Long noncoding RNA ADIRF antisense RNA 1 upregulates insulin receptor substrate 1 to decrease the aggressiveness of osteosarcoma by sponging microRNA-761. Xu L, Tan Y, Xu F, Zhang Y. Bioengineered. 2022 Feb;13(2):2028-2043.

  • CircIL4R activates the PI3K/AKT signaling pathway via the miR-761/TRIM29/PHLPP1 axis and promotes proliferation and metastasis in colorectal cancer. Jiang T, Wang H, Liu L, Song H, Zhang Y, Wang J, Liu L, Xu T, Fan R, Xu Y, Wang S, Shi L, Zheng L, Wang R, Song J. Mol Cancer. 2021 Dec 18;20(1):167.

  • Knockdown of lncRNA PVT1 inhibits the proliferation and accelerates the apoptosis of colorectal cancer cells via the miR‑761/MAPK1 axis. Liu Y, Wu Y, Zhu Z, Gong J, Dou W. Mol Med Rep. 2021 Nov;24(5):794.

  • MicroRNA-761 suppresses tumor progression in osteosarcoma via negatively regulating ALDH1B1. Wang X, Li C, Yao W, Tian Z, Liu Z, Ge H. Life Sci. 2020 Dec 1;262:118544.

  • Long Noncoding RNA KCNQ1OT1 Confers Gliomas Resistance to Temozolomide and Enhances Cell Growth by Retrieving PIM1 From miR-761. Wang W, Han S, Gao W, Feng Y, Li K, Wu D. Cell Mol Neurobiol. 2022 Apr;42(3):695-708.

  • MicroRNA-761 modulates foam cell formation and inflammation through autophagy in the progression of atherosclerosis. Wang C, Yang W, Liang X, Song W, Lin J, Sun Y, Guan X. Mol Cell Biochem. 2020 Nov;474(1-2):135-146.

  • Circular RNA TTBK2 regulates cell proliferation, invasion and ferroptosis via miR-761/ITGB8 axis in glioma. Zhang HY, Zhang BW, Zhang ZB, Deng QJ. Eur Rev Med Pharmacol Sci. 2020 Mar;24(5):2585-2600.

  • LncRNA FENDRR suppresses the progression of NSCLC via regulating miR-761/TIMP2 axis. Zhang G, Wang Q, Zhang X, Ding Z, Liu R. Biomed Pharmacother. 2019 Oct;118:109309.

  • LncRNA FAL1 promotes the development of oral squamous cell carcinoma through regulating the microRNA-761/CRKL pathway. Ye J, Jiao Y. Eur Rev Med Pharmacol Sci. 2019 Jul;23(13):5779-5786.

  • MiR-761 inhibits colorectal cancer cell proliferation and invasion through targeting HDAC1. Xiong W, Yang S, Zhang W, Chen Y, Wang F. Pharmazie. 2019 Feb 1;74(2):111-114.

  • Long non-coding RNA FENDRR inhibits NSCLC cell growth and aggressiveness by sponging miR-761. Zhang MY, Zhang ZL, Cui HX, Wang RK, Fu L. Eur Rev Med Pharmacol Sci. 2018 Dec;22(23):8324-8332.

  • Hsa_circ_0007534/miR-761/ZIC5 regulatory loop modulates the proliferation and migration of glioma cells. Li GF, Li L, Yao ZQ, Zhuang SJ. Biochem Biophys Res Commun. 2018 May 23;499(4):765-771.

  • Extracellular vesicle-encapsulated microRNA-761 enhances pazopanib resistance in synovial sarcoma. Shiozawa K, Shuting J, Yoshioka Y, Ochiya T, Kondo T. Biochem Biophys Res Commun. 2018 Jan 1;495(1):1322-1327.

  • microRNA-761 induces aggressive phenotypes in triple-negative breast cancer cells by repressing TRIM29 expression. Guo GC, Wang JX, Han ML, Zhang LP, Li L. Cell Oncol (Dordr). 2017 Apr;40(2):157-166.

  • MicroRNA-761 is upregulated in hepatocellular carcinoma and regulates tumorigenesis by targeting Mitofusin-2. Zhou X, Zhang L, Zheng B, Yan Y, Zhang Y, Xie H, Zhou L, Zheng S, Wang W. Cancer Sci. 2016 Apr;107(4):424-32.

    • There are 24 references associated with hsa-mir-761. Click here to see the complete list in PubMed.