Precursor miRNA: hsa-mir-548ac

Precursor miRNA

Precursor Name hsa-mir-548ac
Genomic Location chr1:116560024-116560111 (-); nearby genomic features
NCBI GENE ID 100616384
miRBase ID MI0016762
Precursor Sequence 
g                    u     -             uu
 uauuagguuggugcaaaagu auugu gguuuuugcuauu  u
 |||||||||||||||||||| ||||| |||||||||||||   u
 augauccaaucacguuuuca uaacg ccaaaaacgguaa  u
g                    u     g             uu

Mature miRNA

Mature Name hsa-miR-548ac
Mature Sequence 5' - caaaaaccggcaauuacuuuug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018938
Similar miRNAs hsa-miR-548bb-3p, hsa-miR-548d-3p, hsa-miR-548h-3p, hsa-miR-548z (sharing the same seed sequence with hsa-miR-548ac).

References

  • Acute myeloid leukemia cell-derived extracellular vesicles carrying microRNA-548ac regulate hematopoietic function via the TRIM28/STAT3 pathway. Zhao C, Zhao Y, Zhao J, Meng G, Huang S, Liu Y, Wang S, Qi L. Cancer Gene Ther. 2022 Jul;29(7):918-929.

  • A genetic variant associated with multiple sclerosis inversely affects the expression of CD58 and microRNA-548ac from the same gene. Hecker M, Boxberger N, Illner N, Fitzner B, Schröder I, Winkelmann A, Dudesek A, Meister S, Koczan D, Lorenz P, Thiesen HJ, Zettl UK. PLoS Genet. 2019 Feb 7;15(2):e1007961.

  • Susceptibility variants in the CD58 gene locus point to a role of microRNA-548ac in the pathogenesis of multiple sclerosis. Hecker M, Fitzner B, Blaschke J, Blaschke P, Zettl UK. Mutat Res Rev Mutat Res. 2015 Jan-Mar;763:161-7.

  • Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. Patsopoulos NA; Bayer Pharma MS Genetics Working Group; Steering Committees of Studies Evaluating IFNβ-1b and a CCR1-Antagonist; ANZgene Consortium; GeneMSA; International Multiple Sclerosis Genetics Consortium; Esposito F, Reischl J, Lehr S, Bauer D, Heubach J, Sandbrink R, Pohl C, Edan G, Kappos L, Miller D, Montalbán J, Polman CH, Freedman MS, Hartung HP, Arnason BG, Comi G, Cook S, Filippi M, Goodin DS, Jeffery D, O'Connor P, Ebers GC, Langdon D, Reder AT, Traboulsee A, Zipp F, Schimrigk S, Hillert J, Bahlo M, Booth DR, Broadley S, Brown MA, Browning BL, Browning SR, Butzkueven H, Carroll WM, Chapman C, Foote SJ, Griffiths L, Kermode AG, Kilpatrick TJ, Lechner-Scott J, Marriott M, Mason D, Moscato P, Heard RN, Pender MP, Perreau VM, Perera D, Rubio JP, Scott RJ, Slee M, Stankovich J, Stewart GJ, Taylor BV, Tubridy N, Willoughby E, Wiley J, Matthews P, Boneschi FM, Compston A, Haines J, Hauser SL, McCauley J, Ivinson A, Oksenberg JR, Pericak-Vance M, Sawcer SJ, De Jager PL, Hafler DA, de Bakker PI. Ann Neurol. 2011 Dec;70(6):897-912.

  • Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Liu Q, How T, Grubor V, Gao Y, Patel A, Wu H, Zhu J, Blobe GC, Lipsky PE, Chadburn A, Dave SS; Hematologic Malignancies Research Consortium. Blood. 2010 Dec 2;116(23):e118-27.

  • Meta-analysis of genome scans and replication identify CD6, IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci. De Jager PL, Jia X, Wang J, de Bakker PI, Ottoboni L, Aggarwal NT, Piccio L, Raychaudhuri S, Tran D, Aubin C, Briskin R, Romano S; International MS Genetics Consortium; Baranzini SE, McCauley JL, Pericak-Vance MA, Haines JL, Gibson RA, Naeglin Y, Uitdehaag B, Matthews PM, Kappos L, Polman C, McArdle WL, Strachan DP, Evans D, Cross AH, Daly MJ, Compston A, Sawcer SJ, Weiner HL, Hauser SL, Hafler DA, Oksenberg JR. Nat Genet. 2009 Jul;41(7):776-82.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.