Precursor miRNA: hsa-mir-4677

Precursor miRNA

Precursor Name hsa-mir-4677
Genomic Location chr1:243346176-243346255 (+); nearby genomic features
NCBI GENE ID 100616343
miRBase ID MI0017308
Precursor Sequence 
  a      caauu             u   c  u  ccu
gc aagcag     guucuuuggucuu cag ca ga   g
|| ||||||     ||||||||||||| ||| || ||   
cg uucguu     caagaaaccagag guc gu cu   a
  g      -ucau             u   u  -  ucc

Mature miRNA

Mature Name hsa-miR-4677-3p
Mature Sequence 5' - ucugugagaccaaagaacuacu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019761

References

  • Knockdown of circ_0044226 promotes endoplasmic reticulum stress-mediated autophagy and apoptosis in hepatic stellate cells via miR-4677-3p/SEC61G axis. Yuan S, Liu J, Yang L, Zhang X, Zhuang K, He S. J Bioenerg Biomembr. 2024 Jun;56(3):261-271.

  • LINC00265 promotes the viability, proliferation, and migration of bladder cancer cells via the miR-4677-3p/FGF6 axis. Zhi Y, Sun F, Cai C, Li H, Wang K, Sun J, He T, Ji Z, Liu Z, Wang H, Cheng R. Hum Exp Toxicol. 2021 Dec;40(12_suppl):S434-S446.

  • miR-4677-3p participates proliferation and metastases of gastric cancer cell via CEMIP-PI3K/AKT signaling pathway. Mi C, Zhang D, Li Y, Ren M, Ma W, Lu G, He S. Cell Cycle. 2021 Oct;20(19):1978-1987.

  • GLIDR promotes the progression of glioma by regulating the miR-4677-3p/MAGI2 axis. Yu Q, Li X, Feng T. Exp Cell Res. 2021 Sep 1;406(1):112726.

  • Circ_0001421 facilitates glycolysis and lung cancer development by regulating miR-4677-3p/CDCA3. Zhang K, Hu H, Xu J, Qiu L, Chen H, Jiang X, Jiang Y. Diagn Pathol. 2020 Oct 28;15(1):133.

  • LINC02418 promotes malignant behaviors in lung adenocarcinoma cells by sponging miR-4677-3p to upregulate KNL1 expression. Wang T, Zhai R, Lv X, Wang K, Xu J. BMC Pulm Med. 2020 Aug 14;20(1):217.

  • LncRNA LINC02418 regulates proliferation and apoptosis of non-small cell lung cancer cells by regulating miR-4677-3p/SEC61G. Han B. Eur Rev Med Pharmacol Sci. 2019 Dec;23(23):10354-10362.

  • LncRNA TTN-AS1 drives invasion and migration of lung adenocarcinoma cells via modulation of miR-4677-3p/ZEB1 axis. Zhong Y, Wang J, Lv W, Xu J, Mei S, Shan A. J Cell Biochem. 2019 Oct;120(10):17131-17141.

  • miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Friedländer MR, Mackowiak SD, Li N, Chen W, Rajewsky N. Nucleic Acids Res. 2012 Jan;40(1):37-52.

  • Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome. Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM. Hum Mol Genet. 2011 Oct 15;20(20):4025-40.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.