Precursor miRNA: hsa-mir-4667

Precursor miRNA

Precursor Name hsa-mir-4667
Genomic Location chr9:35608094-35608159 (+); nearby genomic features
NCBI GENE ID 100616214
miRBase ID MI0017297
Precursor Sequence 
ugac      g         --aa -     aaa
    ugggga cagaaggag    c ccaag   a
    |||||| |||||||||    | |||||    g
    accccu gucuuccuc    g gguuc   c
-gac      -         ccug a     agu

Mature miRNA

Mature Name hsa-miR-4667-5p
Mature Sequence 5' - acuggggagcagaaggagaacc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0019743
Similar miRNAs hsa-miR-4700-5p, hsa-miR-8089 (sharing the same seed sequence with hsa-miR-4667-5p).

References

  • Burkholderia pseudomallei survival in lung epithelial cells benefits from miRNA-mediated suppression of ATG10. Li Q, Fang Y, Zhu P, Ren CY, Chen H, Gu J, Jia YP, Wang K, Tong WD, Zhang WJ, Pan J, Lu DS, Tang B, Mao XH. Autophagy. 2015;11(8):1293-307.

  • Transcription factors are targeted by differentially expressed miRNAs in primates. Dannemann M, Prüfer K, Lizano E, Nickel B, Burbano HA, Kelso J. Genome Biol Evol. 2012;4(4):552-64.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.