Precursor miRNA: hsa-mir-3940

Precursor miRNA

Precursor Name hsa-mir-3940
Genomic Location chr19:6416410-6416511 (-); nearby genomic features
NCBI GENE ID 100500888
miRBase ID MI0016597
Precursor Sequence 
gcuuauc     -aaa         ----         --      c     au
       gagga    gaucgaggu    ggguugggg  cgggcu ugggg  u
       |||||    |||||||||    |||||||||  |||||| |||||  
       uuccu    uugguucca    cccgacccu  gcccga acucu  u
-ucuucc     cuca         uuca         ag      c     gg

Mature miRNA

Mature Name hsa-miR-3940-3p
Previous Name hsa-miR-3940
Mature Sequence 5' - cagcccggaucccagcccacuu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0018356

References

  • Hsa_Circ_0000021 Sponges miR-3940-3p/KPNA2 Expression to Promote Cervical Cancer Progression. Zeng Q, Feng K, Yu Y, Lv Y. Curr Mol Pharmacol. 2024;17(1):e170223213775.

  • Long non-coding RNA BBOX1-antisense RNA 1 enhances cell proliferation and migration and suppresses apoptosis in oral squamous cell carcinoma via the miR-3940-3p/laminin subunit gamma 2 axis. Zhao C, Shi W, Chen M. Bioengineered. 2022 Apr;13(4):11138-11153.

  • Circular RNA F-circEA-2a expression is increased in gastric adenocarcinoma and inhibits the transition from premature microRNA-3940-5p to mature microRNA-3940-5p. Hu B, Xiao F. Bioengineered. 2022 Mar;13(3):7011-7019.

  • Placental miR-3940-3p Is Associated With Maternal Insulin Resistance in Late Pregnancy. Alvarado-Flores F, Kaneko-Tarui T, Beyer W, Katz J, Chu T, Catalano P, Sadovsky Y, Hivert MF, O'Tierney-Ginn P. J Clin Endocrinol Metab. 2021 Nov 19;106(12):3526-3535.

  • Mesenchymal Stem Cell-Derived Exosomal microRNA-3940-5p Inhibits Colorectal Cancer Metastasis by Targeting Integrin α6. Li T, Wan Y, Su Z, Li J, Han M, Zhou C. Dig Dis Sci. 2021 Jun;66(6):1916-1927.

  • MiR-3940-5p promotes granulosa cell proliferation through targeting KCNA5 in polycystic ovarian syndrome. Gao L, Wu D, Wu Y, Yang Z, Sheng J, Lin X, Huang H. Biochem Biophys Res Commun. 2020 Apr 16;524(4):791-797.

  • Downregulation of miR-3940-5p promotes T-cell activity by targeting the cytokine receptor IL-2R gamma on human cutaneous T-cell lines. Wang Y, Wang K, Dang N, Wang L, Zhang M. Immunobiology. 2016 Dec;221(12):1378-1381.

  • Expression of miR-150 and miR-3940-5p is reduced in non-small cell lung carcinoma and correlates with clinicopathological features. Sun Y, Su B, Zhang P, Xie H, Zheng H, Xu Y, Du Q, Zeng H, Zhou X, Chen C, Gao W. Oncol Rep. 2013 Feb;29(2):704-12.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Deep sequencing of human nuclear and cytoplasmic small RNAs reveals an unexpectedly complex subcellular distribution of miRNAs and tRNA 3' trailers. Liao JY, Ma LM, Guo YH, Zhang YC, Zhou H, Shao P, Chen YQ, Qu LH. PLoS One. 2010 May 14;5(5):e10563.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.