Precursor miRNA: hsa-mir-378a

Precursor miRNA

Precursor Name hsa-mir-378a
Genomic Location chr5:149732825-149732890 (+); nearby genomic features
NCBI GENE ID 494327
MIM ID 611957
miRBase ID MI0000786
Precursor Sequence 
   g  c              ugu      ccu
agg cu cugacuccaggucc   guguua   a
||| || ||||||||||||||   ||||||   
ucc ga gacugagguucagg   cacgau   g
   g  a              --u      aaa

Mature miRNA

Mature Name hsa-miR-378a-3p
Previous Name hsa-miR-422b;hsa-miR-378
Mature Sequence 5' - acuggacuuggagucagaaggc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000732
Similar miRNAs hsa-miR-378b, hsa-miR-378c, hsa-miR-378d, hsa-miR-378e, hsa-miR-378f, hsa-miR-378h, hsa-miR-378i, hsa-miR-422a (sharing the same seed sequence with hsa-miR-378a-3p).

References

  • Exploring the regulatory role of FBXL19-AS1 in triple-negative breast cancer through the miR-378a-3p/OTUB2 axis. Guo C, Zhang M, Jin X, Zhu C, Qian J, Tao M. Cell Biochem Funct. 2024 Jun;42(4):e4020.

  • miR-378a-5p represses Barrett's esophagus cells proliferation, migration and invasion through targeting TSPAN8. Xie X, Wei D. Cell Mol Biol (Noisy-le-grand). 2024 Feb 29;70(2):97-103.

  • MiR-378a-5p exerts a radiosensitizing effect on CRC through LRP8/β-catenin axis. Hu G, Che P, Deng L, Liu L, Liao J, Liu Q. Cancer Biol Ther. 2024 Dec 31;25(1):2308165.

  • miRNA-378 Is Downregulated by XBP1 and Inhibits Growth and Migration of Luminal Breast Cancer Cells. Arabkari V, Barua D, Hossain MM, Webber M, Smith T, Gupta A, Gupta S. Int J Mol Sci. 2023 Dec 22;25(1):186.

  • Association between circHIPK3/miR-378a-3p/HDAC4 axis and osteoporotic fractures: A comprehensive investigation. Wang L, Sheng Z, Yao T. J Orthop Surg (Hong Kong). 2023 Sep-Dec;31(3):10225536231219637.

  • Bone Marrow Mesenchymal Stem Cells Release miR-378a-5p-Carried Extracellular Vesicles to Alleviate Rheumatoid Arthritis. Zhang Y, Jiao Z, Wang S. J Innate Immun. 2023;15(1):893-910.

  • Compromised diabetic heart function is not affected by miR-378a upregulation upon hyperglycemia. Florczyk-Soluch U, Polak K, Sabo R, Martyniak A, StÄ™pniewski J, Dulak J. Pharmacol Rep. 2023 Dec;75(6):1556-1570.

  • LncRNA HCG27 Promotes Glucose Uptake Ability of HUVECs by MiR-378a-3p/MAPK1 Pathway. Zhang JY, Jiang Y, Wei LJ, Zhou X, Zhu SL, Zhang HT, Chen YT, Gao P, Yu J, Wang SS, Feng L. Curr Med Sci. 2023 Aug;43(4):784-793.

  • Circ_0000033 up-regulates NUAK2 by sequestering miR-378a-3p to promote breast tumorigenesis. Dai Y, Shi W, Qiu Y, Xu T, Lin J, Su Y. Environ Mol Mutagen. 2023 Jul;64(6):359-370.

  • m Liu H, Jiang Y, Lu J, Peng C, Ling Z, Chen Y, Chen D, Tong R, Zheng S, Wu J. Epigenetics. 2023 Dec;18(1):2204772.

  • LINC01023 Promotes the Hepatoblastoma Tumorigenesis via miR-378a-5p/WNT3 Axis. Bhandari R, Shaikh II, Bhandari R, Chapagain S. Mol Cell Biochem. 2023 Aug;478(8):1867-1885.

  • Glucocorticoid-induced microRNA-378 signaling mediates the progression of pancreatic cancer by enhancing autophagy. Liu L, Han S, Xiao X, An X, Gladkich J, Hinz U, Hillmer S, Hoppe-Tichy T, Xu Y, Schaefer M, Strobel O, Herr I. Cell Death Dis. 2022 Dec 19;13(12):1052.

  • miR-378a-3p promotes renal cell carcinoma proliferation, migration, and invasion by targeting TOB2. Bao N, Zhang P, Zhu Y, Du P, Jin G, Wu B, Ding T. Clin Transl Oncol. 2023 Mar;25(3):748-757.

  • MiR-378a-3p acts as a tumor suppressor in gastric cancer Xu X, Li Y, Liu G, Li K, Chen P, Gao Y, Liang W, Xi H, Wang X, Wei B, Li H, Chen L. Cancer Biol Med. 2022 Oct 18;19(12):1662-82.

  • miR-378 associated with proliferation, migration and apoptosis properties in A549 cells and targeted NPNT in COPD. Qian G, Liao Q, Li G, Yin F. PeerJ. 2022 Sep 15;10:e14062.

  • H19 may regulate the immune cell infiltration in carcinogenesis of gastric cancer through miR-378a-5p/SERPINH1 signaling. Li J, Han T, Wang X, Wang Y, Chen X, Chen W, Yang Q. World J Surg Oncol. 2022 Sep 14;20(1):295.

  • Knockdown of lncRNA ACTA2-AS1 reverses cisplatin resistance of ovarian cancer cells via inhibition of miR-378a-3p-regulated Wnt5a. Lin C, Zheng M, Yang Y, Chen Y, Zhang X, Zhu L, Zhang H. Bioengineered. 2022 Apr;13(4):9829-9838.

  • High miRNA-378 expression has high diagnostic values for pulmonary tuberculosis and predicts adverse outcomes. Sun X, Liu K, Zhao Y, Zhang T. BMC Mol Cell Biol. 2022 Mar 19;23(1):14.

  • miR-378a regulates keratinocyte responsiveness to interleukin-17A in psoriasis. Xia P, Pasquali L, Gao C, Srivastava A, Khera N, Freisenhausen JC, Luo L, Rosén E, van Lierop A, Homey B, Pivarcsi A, Sonkoly E. Br J Dermatol. 2022 Aug;187(2):211-222.

  • microRNA-378a-3p regulates the progression of hepatocellular carcinoma by regulating PD-L1 and STAT3. Li Y, Zhou T, Cheng X, Li D, Zhao M, Zheng WV. Bioengineered. 2022 Mar;13(3):4730-4743.

    • There are 152 references associated with hsa-mir-378a. Click here to see the complete list in PubMed.