Precursor miRNA: hsa-mir-320c-1

Precursor miRNA

Precursor Name hsa-mir-320c-1
Genomic Location chr18:21683518-21683589 (+); nearby genomic features
NCBI GENE ID 100302135
miRBase ID MI0003778
Precursor Sequence 
--aaaaaugag        uu       c    cag
           gccuucuc  cccaguu uucc   a
           ||||||||  ||||||| ||||   
           ugggagag  gggucga aagg   g
uaaaaaaaaga        uu       a    acu

Mature miRNA

Mature Name hsa-miR-320c
Mature Sequence 5' - aaaagcuggguugagagggu - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005793
Similar miRNAs hsa-miR-320a-3p, hsa-miR-320b, hsa-miR-320d, hsa-miR-4429 (sharing the same seed sequence with hsa-miR-320c).

References

  • Plasma microRNA-320c as a Potential Biomarker for the Severity of Knee Osteoarthritis and Regulates cAMP Responsive Element Binding Protein 5 (CREB5) in Chondrocytes. Zhou R, Zhao L, Wang Q, Cheng Y, Song M, Huang C. Dis Markers. 2024 Mar 20;2024:9936295.

  • High-glucose induced toxicity in HK-2 cells can be alleviated by inhibition of miRNA-320c. Sun Y, Qu H, Song Q, Shen Y, Wang L, Niu X. Ren Fail. 2022 Dec;44(1):1388-1398.

  • miR-320c Regulates SERPINA1 Expression and Is Induced in Patients With Pulmonary Disease. Matamala N, Lara B, Gómez-Mariano G, Martínez S, Vázquez-Domínguez I, Otero-Sobrino Á, Muñoz-Callejas A, Sánchez E, Esquinas C, Bustamante A, Cadenas S, Curi S, Lázaro L, Martínez MT, Rodríguez E, Miravitlles M, Torres-Duran M, Herrero I, Michel FJ, Castillo S, Hernández-Pérez JM, Blanco I, Casas F, Martínez-Delgado B. Arch Bronconeumol. 2021 Jul;57(7):457-463.

  • The MiR-320 Family Is Strongly Downregulated in Patients with COVID-19 Induced Severe Respiratory Failure. Duecker RP, Adam EH, Wirtz S, Gronau L, Khodamoradi Y, Eberhardt FJ, Donath H, Gutmann D, Vehreschild MJGT, Zacharowski K, Kreyenberg H, Chiocchetti AG, Zielen S, Schubert R. Int J Mol Sci. 2021 Sep 26;22(19):10351.

  • The Potential Role of miRNA-19b-3p and miRNA-320c in Patients with Moderate Bronchial Asthma. Aripova A, Akparova A, Bersimbaev R. Microrna. 2020;9(5):373-377.

  • MiR-320c prevents the malignant development of cervical cancer by regulating GABRP level. Li Y, Huang Y, Zhou C, Jiang PC, Pan W. Eur Rev Med Pharmacol Sci. 2020 Sep;24(17):8731-8739.

  • MicroRNA-320c inhibits development of osteoarthritis through downregulation of canonical Wnt signaling pathway. Hu S, Mao G, Zhang Z, Wu P, Wen X, Liao W, Zhang Z. Life Sci. 2019 Jul 1;228:242-250.

  • CDK6 and miR-320c Co-Regulate Chondrocyte Catabolism Through NF-κB Signaling Pathways. Sun H, Huang Z, Wu P, Chang Z, Liao W, Zhang Z. Cell Physiol Biochem. 2018;51(2):909-923.

  • Down-regulation of miRNA-320c promotes tumor growth and metastasis and predicts poor prognosis in human glioma. Lv QL, Zhu HT, Li HM, Cheng XH, Zhou HH, Chen SH. Brain Res Bull. 2018 May;139:125-132.

  • Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs. Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T, Miyajima A. Sci Rep. 2017 Aug 10;7(1):7780.

  • Association of MicroRNAs and YRNAs With Platelet Function. Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF, Mayr M. Circ Res. 2016 Feb 5;118(3):420-432.

  • MicroRNA-320c inhibits tumorous behaviors of bladder cancer by targeting Cyclin-dependent kinase 6. Wang X, Wu J, Lin Y, Zhu Y, Xu X, Xu X, Liang Z, Li S, Hu Z, Zheng X, Xie L. J Exp Clin Cancer Res. 2014 Sep 2;33(1):69.

  • miR-320c regulates gemcitabine-resistance in pancreatic cancer via SMARCC1. Iwagami Y, Eguchi H, Nagano H, Akita H, Hama N, Wada H, Kawamoto K, Kobayashi S, Tomokuni A, Tomimaru Y, Mori M, Doki Y. Br J Cancer. 2013 Jul 23;109(2):502-11.

  • MicroRNA-199a-3p, microRNA-193b, and microRNA-320c are correlated to aging and regulate human cartilage metabolism. Ukai T, Sato M, Akutsu H, Umezawa A, Mochida J. J Orthop Res. 2012 Dec;30(12):1915-22.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Discovering microRNAs from deep sequencing data using miRDeep. Friedländer MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N. Nat Biotechnol. 2008 Apr;26(4):407-15.

  • Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E. Genome Res. 2006 Oct;16(10):1289-98.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.