Precursor miRNA: hsa-mir-320b-2

Precursor miRNA

Precursor Name hsa-mir-320b-2
Genomic Location chr1:224257040-224257110 (-); nearby genomic features
NCBI GENE ID 100313769
miRBase ID MI0003839
Precursor Sequence 
---g  u   ag        uu     -a       a
    uc cuu  gcuuucuc  cccag  uuuccca a
    || |||  ||||||||  |||||  ||||||| 
    ag gaa  cgggagag  ggguc  aaagggu g
aaaa  -   aa        uu     ga       u

Mature miRNA

Mature Name hsa-miR-320b
Mature Sequence 5' - aaaagcuggguugagagggcaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005792
Similar miRNAs hsa-miR-320a-3p, hsa-miR-320c, hsa-miR-320d, hsa-miR-4429 (sharing the same seed sequence with hsa-miR-320b).

References

  • Platelet Microparticle-Derived MiR-320b Inhibits Hypertension with Atherosclerosis Development by Targeting ETFA. He Y, Jiang Y, Wu F, Zhang X, Liang S, Ye Z. Int Heart J. 2024;65(2):329-338.

  • Placenta-derived exosomes exacerbate beta cell dysfunction in gestational diabetes mellitus through delivery of miR-320b. Wang Y, Yuan Y, Shen S, Ge Z, Zhu D, Bi Y. Front Endocrinol (Lausanne). 2024 Jan 8;14:1282075.

  • MiR-320b aberrant expression enhances the radioresistance of human glioma via upregulated expression of ALDH1A3. Mao P, Wang T, Gao K, Li Y, Du C, Wang M. Aging (Albany NY). 2023 Mar 29;15(6):2347-2357.

  • MIR-320a/b inhibits cell viability and cell cycle progression by targeting aryl hydrocarbon receptor nuclear translocator-like in acute promyelocyte leukaemia. Hu D, Shen Z, Yuan L. Pol J Pathol. 2022;73(2):99-110.

  • Circ_NNT suppresses the apoptosis and inflammation in glucose-induced human retinal pigment epithelium by regulating miR-320b/TIMP3 axis in diabetic retinopathy. Liu Q, Liu C, Dong Y, Li H, Ren J. Clin Immunol. 2022 May;238:109023.

  • Circulating miR-320b and miR-483-5p levels are associated with COVID-19 in-hospital mortality. Giuliani A, Matacchione G, Ramini D, Di Rosa M, Bonfigli AR, Sabbatinelli J, Monsurrò V, Recchioni R, Marcheselli F, Marchegiani F, Piacenza F, Cardelli M, Galeazzi R, Pomponio G, Ferrarini A, Gabrielli A, Svegliati Baroni S, Moretti M, Sarzani R, Giordano P, Cherubini A, Corsonello A, Antonicelli R, Procopio AD, Ferracin M, Bonafè M, Lattanzio F, Olivieri F. Mech Ageing Dev. 2022 Mar;202:111636.

  • MiR-320b/RAD21 axis affects hepatocellular carcinoma radiosensitivity to ionizing radiation treatment through DNA damage repair signaling. Wang J, Zhao H, Yu J, Xu X, Jing H, Li N, Tang Y, Wang S, Li Y, Cai J, Jin J. Cancer Sci. 2021 Feb;112(2):575-588.

  • Low miR-150-5p and miR-320b Expression Predicts Reduced Survival of COPD Patients. Keller A, Ludwig N, Fehlmann T, Kahraman M, Backes C, Kern F, Vogelmeier CF, Diener C, Fischer U, Biertz F, Herr C, Jörres RA, Lenhof HP, Bals R, Meese E. Cells. 2019 Sep 27;8(10):1162.

  • Identification of the novel 3' UTR sequences of human IL-21 mRNA as potential targets of miRNAs. Enomoto Y, Takagi R, Naito Y, Kiniwa T, Tanaka Y, Hamada-Tsutsumi S, Kawano M, Matsushita S, Ochiya T, Miyajima A. Sci Rep. 2017 Aug 10;7(1):7780.

  • Overexpression of Mitochondria Mediator Gene TRIAP1 by miR-320b Loss Is Associated with Progression in Nasopharyngeal Carcinoma. Li Y, Tang X, He Q, Yang X, Ren X, Wen X, Zhang J, Wang Y, Liu N, Ma J. PLoS Genet. 2016 Jul 18;12(7):e1006183.

  • Association of MicroRNAs and YRNAs With Platelet Function. Kaudewitz D, Skroblin P, Bender LH, Barwari T, Willeit P, Pechlaner R, Sunderland NP, Willeit K, Morton AC, Armstrong PC, Chan MV, Lu R, Yin X, Gracio F, Dudek K, Langley SR, Zampetaki A, de Rinaldis E, Ye S, Warner TD, Saxena A, Kiechl S, Storey RF, Mayr M. Circ Res. 2016 Feb 5;118(3):420-432.

  • miR-320b suppresses cell proliferation by targeting c-Myc in human colorectal cancer cells. Wang H, Cao F, Li X, Miao H, E J, Xing J, Fu CG. BMC Cancer. 2015 Oct 20;15:748.

  • Platelet-derived growth factor-BB enhances MSC-mediated cardioprotection via suppression of miR-320 expression. Xu B, Luo Y, Liu Y, Li BY, Wang Y. Am J Physiol Heart Circ Physiol. 2015 May 1;308(9):H980-9.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Discovering microRNAs from deep sequencing data using miRDeep. Friedländer MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N. Nat Biotechnol. 2008 Apr;26(4):407-15.

  • Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA. Genome Res. 2008 Apr;18(4):610-21.

  • Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E. Genome Res. 2006 Oct;16(10):1289-98.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.