Precursor miRNA: hsa-mir-3183

Precursor miRNA

Precursor Name hsa-mir-3183
Genomic Location chr17:1022476-1022559 (-); nearby genomic features
NCBI GENE ID 100422835
miRBase ID MI0014225
Precursor Sequence 
       -  g        --    u   u     cag  a  u
cucugcc cu ccucucuc  ggag cgc cggag   uc cg u
||||||| || ||||||||  |||| ||| |||||   || || 
gggacgg ga ggagggag  ccuc gcg gccuc   ag gc g
       a  -        cu    c   -     cua  -  a

Mature miRNA

Mature Name hsa-miR-3183
Mature Sequence 5' - gccucucucggagucgcucgga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015063
Similar miRNAs hsa-miR-4723-3p, hsa-miR-6769b-3p (sharing the same seed sequence with hsa-miR-3183).

References

  • Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia. Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML. Leukemia. 2011 Sep;25(9):1389-99.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.