Precursor miRNA: hsa-mir-3175

Precursor miRNA

Precursor Name hsa-mir-3175
Genomic Location chr15:92904399-92904475 (+); nearby genomic features
NCBI GENE ID 100422995
miRBase ID MI0014209
Precursor Sequence 
      --   c         a   ag      cug  c
ccuggg  ggg ggggagaga cgc  ugacgu   gc g
||||||  ||| ||||||||| |||  ||||||   ||  c
ggaccc  ccc cuccucuuu gcg  gcugua   cg g
      au   c         c   -g      -cg  u

Mature miRNA

Mature Name hsa-miR-3175
Mature Sequence 5' - cggggagagaacgcagugacgu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015052

References

  • DCAF1-targeting microRNA-3175 activates Nrf2 signaling and inhibits dexamethasone-induced oxidative injury in human osteoblasts. Chen J, Liang JQ, Zhen YF, Chang L, Zhou ZT, Shen XJ. Cell Death Dis. 2021 Oct 29;12(11):1024.

  • Silencing of microRNA-3175 represses cell proliferation and invasion in prostate cancer by targeting the potential tumor-suppressor SCN4B. Huang H, Qing XY, Zhou Q, Li HD, Hu ZY. Kaohsiung J Med Sci. 2021 Jan;37(1):20-26.

  • miR-3175 and miR-134 affect proliferation, invasion and apoptosis of glioma cells through PI3K/AKT signaling pathway. Qi A, Han J, Jia F, Liu C. J BUON. 2019 Nov-Dec;24(6):2465-2474.

  • MiR-3175 promotes epithelial-mesenchymal transition by targeting Smad7 in human conjunctiva and pterygium. Zhong X, Tang J, Li H, Shi X, Wu Y, Xia D, Zhang H, Ye J, Wu H. FEBS Lett. 2020 Apr;594(7):1207-1217.

  • HOXB1 Is a Tumor Suppressor Gene Regulated by miR-3175 in Glioma. Han L, Liu D, Li Z, Tian N, Han Z, Wang G, Fu Y, Guo Z, Zhu Z, Du C, Tian Y. PLoS One. 2015 Nov 13;10(11):e0142387.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.