Precursor miRNA: hsa-mir-3152

Precursor miRNA

Precursor Name hsa-mir-3152
Genomic Location chr9:18573306-18573379 (+); nearby genomic features
NCBI GENE ID 100422869
miRBase ID MI0014179
Precursor Sequence 
                              -a  cu
gugcagaguuauugccucuguucuaacaca  ga  a
||||||||||||||||||||||||||||||  ||   g
cacgucucaauaacggggauaagauugugu  cu  g
                              cc  uc

Mature miRNA

Mature Name hsa-miR-3152-3p
Previous Name hsa-miR-3152
Mature Sequence 5' - uguguuagaauaggggcaauaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015025

References

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • Discovery of novel microRNAs in female reproductive tract using next generation sequencing. Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH. PLoS One. 2010 Mar 10;5(3):e9637.

  • Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E. Genome Res. 2006 Oct;16(10):1289-98.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.