Precursor miRNA: hsa-mir-297

Precursor miRNA

Precursor Name hsa-mir-297
Genomic Location chr4:110860582-110860647 (-); nearby genomic features
NCBI GENE ID 100126354
MIM ID 615520
miRBase ID MI0005775
Precursor Sequence 
u u       u       -             a
 g auguaug gugcaug ugcauguaugugu u
 | ||||||| ||||||| ||||||||||||| 
 c uauauac cauguau auguauauauaca a
a -       u       u             u

Mature miRNA

Mature Name hsa-miR-297
Mature Sequence 5' - auguaugugugcaugugcaug - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004450

References

  • MiR-297 inhibits tumour progression of liver cancer by targeting PTBP3. Lu N, Min J, Peng L, Huang S, Chai X, Wang S, Wang J. Cell Death Dis. 2023 Aug 26;14(8):564.

  • miR-297 inhibits expression of progesterone receptor and decidualization in eutopic endometria of endometriosis. Liu T, Xiao L, Pei T, Luo B, Tan J, Long Y, Huang X, Ouyang Y, Huang W. J Obstet Gynaecol Res. 2023 Mar;49(3):956-965.

  • Inhibition of microRNA-297 alleviates THLE-2 cell injury induced by hypoxia/reoxygenation by inhibiting NLRP3 inflammasome activation via sirtuin 3. Yue Y, Du Z, Tao J, Shi L. Can J Physiol Pharmacol. 2022 Feb;100(2):125-133.

  • The circular RNA hsa_circ_0007623 acts as a sponge of microRNA-297 and promotes cardiac repair. Zhang Q, Sun W, Han J, Cheng S, Yu P, Shen L, Fan M, Tong H, Zhang H, Chen J, Chen X. Biochem Biophys Res Commun. 2020 Mar 19;523(4):993-1000.

  • MiR-297 alleviates LPS-induced A549 cell and mice lung injury via targeting cyclin dependent kinase 8. Xi X, Yao Y, Liu N, Li P. Int Immunopharmacol. 2020 Mar;80:106197.

  • miR-297 Protects Human Umbilical Vein Endothelial Cells against LPS-Induced Inflammatory Response and Apoptosis. Yao Y, Jia H, Wang G, Ma Y, Sun W, Li P. Cell Physiol Biochem. 2019;52(4):696-707.

  • Changes in the Level of Circulating hsa-miR-297 and hsa-miR-19b-3p miRNA Are Associated with Generalization of Prostate Cancer. Osip'yants AI, Knyazev EN, Galatenko AV, Nyushko KM, Galatenko VV, Shkurnikov MY, Alekseev BY. Bull Exp Biol Med. 2017 Jan;162(3):379-382.

  • miR-297 acts as an oncogene by targeting GPC5 in lung adenocarcinoma. Sun Y, Zhao J, Yin X, Yuan X, Guo J, Bi J. Cell Prolif. 2016 Oct;49(5):636-43.

  • Cellular microRNAs up-regulate transcription via interaction with promoter TATA-box motifs. Zhang Y, Fan M, Zhang X, Huang F, Wu K, Zhang J, Liu J, Huang Z, Luo H, Tao L, Zhang H. RNA. 2014 Dec;20(12):1878-89.

  • A miR-297/hypoxia/DGK-α axis regulating glioblastoma survival. Kefas B, Floyd DH, Comeau L, Frisbee A, Dominguez C, Dipierro CG, Guessous F, Abounader R, Purow B. Neuro Oncol. 2013 Dec;15(12):1652-63.

  • miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Xu K, Liang X, Shen K, Cui D, Zheng Y, Xu J, Fan Z, Qiu Y, Li Q, Ni L, Liu J. Biochem J. 2012 Sep 1;446(2):291-300.

  • Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Triboulet R, Mari B, Lin YL, Chable-Bessia C, Bennasser Y, Lebrigand K, Cardinaud B, Maurin T, Barbry P, Baillat V, Reynes J, Corbeau P, Jeang KT, Benkirane M. Science. 2007 Mar 16;315(5818):1579-82.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.