Precursor miRNA: hsa-mir-223

Precursor miRNA

Precursor Name hsa-mir-223
Genomic Location chrX:66018870-66018979 (+); nearby genomic features
NCBI GENE ID 407008
MIM ID 300694
miRBase ID MI0000300
Precursor Sequence 
c    ccuccu   -     a    cc u              gaguug       cau
 cugg      gca gugcc cgcu  g guauuugacaagcu      gacacuc   g
 ||||      ||| ||||| ||||  | ||||||||||||||      |||||||    u
 gacc      cgu cacgg guga  c cauaaacuguuuga      cugugag   g
-    ---auu   a     c    ac c              ------       aug

Mature miRNA

Mature Name hsa-miR-223-5p
Previous Name hsa-miR-223*
Mature Sequence 5' - cguguauuugacaagcugaguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004570

Mature miRNA

Mature Name hsa-miR-223-3p
Previous Name hsa-miR-223
Mature Sequence 5' - ugucaguuugucaaauacccca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000280

References

  • The simultaneous miR-155-5p overexpression and miR-223-3p inhibition can activate pEMT in oral squamous cell carcinoma. Zhou R, Chen Z, Cai Y, Zhang H, Mao S, Zhuang Y, Zheng J. J Appl Oral Sci. 2024 Oct 21;32:e20240215.

  • miR-223-5p serves as a diagnostic biomarker for acute coronary syndrome and its predictive value for the clinical outcome after PCI. Zhang S, Yang G, Chen Y, Liu W. BMC Cardiovasc Disord. 2024 Aug 13;24(1):423.

  • MiR-223-3p in Cancer Development and Cancer Drug Resistance: Same Coin, Different Faces. Barbagallo D, Ponti D, Bassani B, Bruno A, Pulze L, Akkihal SA, George-William JN, Gundamaraju R, Campomenosi P. Int J Mol Sci. 2024 Jul 26;25(15):8191.

  • MicroRNA-223-3p Targeting SGK1 Regulates Apoptosis and Inflammation in Sepsis-Associated Acute Kidney Injury. Chen D, Li K, Pan L, Chen M, Zhang X, Chen H, Xu J, Cai F. Kidney Blood Press Res. 2024;49(1):657-666.

  • LncRNA MAGI2-AS3 promotes fracture healing through downregulation of miR-223-3p. Dong Z, Hu B, Wang S, Wang M, Sun S, Liu X, Li D, Wu D. J Orthop Surg Res. 2024 Jun 22;19(1):370.

  • LncRNA MIR181A2HG inhibits keratinocytes proliferation through miR-223-3p/SOX6 axis. Li M, Niu M, Fan X, Chen F, Cao H, Liu Q, Gan S, Yue P, Gao J. Aging (Albany NY). 2024 Jun 6;16(11):9846-9858.

  • circCUL3 drives malignant progression of cervical cancer by activating autophagy through sponge miR-223-3p upregulation of ATG7. Qin J, Chen Y, Zhao X, Yu J. Gene. 2024 Oct 20;925:148572.

  • Microglia-derived exosomes selective sorted by YB-1 alleviate nerve damage and cognitive outcome in Alzheimer's disease. Wei H, Zhu Z, Xu Y, Lin L, Chen Q, Liu Y, Li Y, Zhu X. J Transl Med. 2024 May 16;22(1):466.

  • PITPNA-AS1 Inhibits Cell Proliferation and Migration in Ovarian Cancer by Regulating the MIR-223-3p/RHOB Axis. Zhang F, Zhang M, Chen Z, Yu B, He X, Luo Y, Ai F, Hu W. Rev Invest Clin. 2024 May 6;76(2):103-115.

  • Circular RNA hsa_circ_0094976 modulates GPR155 to inhibit gastric adenocarcinoma malignant characteristics by targeting miR-223-3p. Liu L, Li X, Song L, Yang Y, Li B. Pathol Res Pract. 2024 May;257:155325.

  • [circDDX17 targets miR-223-3p / RIP3 to regulate the proliferation and apoptosis of non-small cell lung cancer cells]. Ding CZ, Wang GL, Jiang GQ, Wang HT, Liu YY, Zhang HL, Sun F, Wei L. Zhonghua Zhong Liu Za Zhi. 2024 Mar 23;46(3):239-248.

  • MicroRNA-223-3p downregulates the inflammatory response in preeclampsia placenta via targeting NLRP3. Liu X, Li Z, Lu D. BMC Pregnancy Childbirth. 2024 Mar 6;24(1):175.

  • Exosomal miR-223 promotes ARDS by targeting insulin-like growth factor 1 receptor: A cell communication study. Li M, Zhuang L, Jiang T, Sun L. Exp Lung Res. 2024;50(1):42-52.

  • Platelet Exosome-Derived miR-223-3p Regulates Pyroptosis in the Cell Model of Sepsis-Induced Acute Renal Injury by Targeting Mediates NLRP3. Wan P, Tan X, Sheng M, Xiang Y, Wang P, Yu M. Crit Rev Immunol. 2024;44(3):53-65.

  • LncRNA FGD5-AS1 Alleviates Inflammation in Allergic Rhinitis through the miR-223-3p/COX11 Axis. Li B, Yu X, Pang F. Int Arch Allergy Immunol. 2024;185(3):201-211.

  • The role of miR-223 in breast cancer; an integrated analysis. Sahin Y, Altan Z, Karabulut A, Saadat KASM, Arslan A. Mol Biol Rep. 2023 Dec;50(12):10179-10188.

  • Cross talk of tumor protein D52 (TPD52) with KLF9, PKCε, and MicroRNA 223 in ovarian cancer. Khan K, Zafar S, Badshah Y, Ashraf NM, Rafiq M, Danish L, Shabbir M, Trembley JH, Afsar T, Almajwal A, Razak S. J Ovarian Res. 2023 Oct 13;16(1):202.

  • Exosomal microRNA-223 from neutrophil-like cells inhibits osteogenic differentiation of PDLSCs through the cGMP-PKG signaling pathway. Zhang Z, Wang P, Zheng Y, Wang M, Chou J, Wang Z. J Periodontal Res. 2023 Dec;58(6):1315-1325.

  • Lower Plasma miR-223 Level Is Associated with Clopidogrel Resistance in Acute Coronary Syndrome: A Systematic Review and Meta-Analysis. Cheng H, Yang M, Hao J, Chen K, Tan Q, He S, Mao F, Yang M, Lin Y, Yang J. J Interv Cardiol. 2023 Aug 17;2023:9322188.

  • Clinical and pathological correlation between urinary exosome miR-223 and IgAN patients. Song J, Qin X, Li H, Huang G, Bi H. Clin Nephrol. 2023 Nov;100(5):209-215.

    • There are 382 references associated with hsa-mir-223. Click here to see the complete list in PubMed.