Precursor miRNA: hsa-mir-219a-1

Precursor miRNA

Precursor Name hsa-mir-219a-1
Genomic Location chr6:33207835-33207944 (+); nearby genomic features
NCBI GENE ID 407002
MIM ID 611500
miRBase ID MI0000296
Precursor Sequence 
-    c --------c    c       cu   u     a  g         a   uau
 ccgc c         gggc gcggcuc  gau gucca ac caauucucg guc   g
 |||| |         |||| |||||||  ||| ||||| || ||||||||| |||    g
 ggcg g         cccg cgccgag  cug caggu ug guugagagc cgg   c
g    a cuccaaacc    c       cc   -     c  a         -   ccu

Mature miRNA

Mature Name hsa-miR-219a-5p
Previous Name hsa-miR-219
Mature Sequence 5' - ugauuguccaaacgcaauucu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000276
Similar miRNAs hsa-miR-4782-3p, hsa-miR-6766-3p (sharing the same seed sequence with hsa-miR-219a-5p).

Mature miRNA

Mature Name hsa-miR-219a-1-3p
Mature Sequence 5' - agaguugagucuggacgucccg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004567

References

  • Investigation of the effects of mir-219-1 gene variants on the development of disease in non-small cell lung cancer patients. Tas SK, Coskunpinar E, Yildiz P, BayraktaroÄŸlu M, Kose T, Altunkanat D, Kirkik D, Tukenmez M. Afr Health Sci. 2022 Dec;22(4):37-45.

  • Epigenetic Modification of MicroRNA-219-1 and Its Association with Glioblastoma Multiforme. Ghasemi A, Mohammadi A, Fallah S. Biochemistry (Mosc). 2021 Apr;86(4):420-432.

  • Down-regulation of miR-219-5p increase the risk of cancer-related mortality in patients with prostate cancer. Tang S, Jiang H, Cao Z, Zhou Q. Postgrad Med J. 2022 Aug;98(1162):577-583.

  • CircPRKCI regulates proliferation, migration and cycle of lung adenocarcinoma cells by targeting miR-219a-5p-regulated CAMK1D. Sui MH, Zhang WW, Geng DM, Sun DJ. Eur Rev Med Pharmacol Sci. 2021 Feb;25(4):1899-1909.

  • MicroRNA 219-5p inhibits alveolarization by reducing platelet derived growth factor receptor-alpha. Freeman A, Qiao L, Olave N, Rezonzew G, Gentle S, Halloran B, Pryhuber GS, Gaggar A, Tipple TE, Ambalavanan N, Lal CV. Respir Res. 2021 Feb 17;22(1):57.

  • miR-219a suppresses human trophoblast cell invasion and proliferation by targeting vascular endothelial growth factor receptor 2 (VEGFR2). Zhou G, Li Z, Hu P, Wang J, Fu J, Wei B, Zhang Y. J Assist Reprod Genet. 2021 Feb;38(2):461-470.

  • miR-219a-1 inhibits colon cancer cells proliferation and invasion by targeting Xu K, Shi J, Mo D, Yang Y, Fu Q, Luo Y. Cancer Biol Ther. 2020 Dec 1;21(12):1163-1170.

  • MicroRNA-219 inhibits cell viability and metastasis in papillary thyroid carcinoma by targeting EYA2. Liu HM, Dong AB, Hua H, Sun YH, Wang JR, Yu QQ, Zhang JH, Sun WH. Eur Rev Med Pharmacol Sci. 2020 Sep;24(18):9556-9564.

  • MiR-219-5p inhibits prostate cancer cell growth and metastasis by targeting HMGA2. Huang WT, Zhang H, Jin Z, Li K, Hu C, Li ML, Situ J. Eur Rev Med Pharmacol Sci. 2020 May;24(9):4710-4718.

  • miR-219a-5p enhances the radiosensitivity of non-small cell lung cancer cells through targeting CD164. Wei T, Cheng S, Fu XN, Feng LJ. Biosci Rep. 2020 Jul 31;40(7):BSR20192795.

  • HOTAIR inhibits the proliferation of glioblastoma cells by targeting miR-219. Li H, Guan C. Cancer Biomark. 2020;28(1):41-47.

  • XB130, regulated by miR-203, miR-219, and miR-4782-3p, mediates the proliferation and metastasis of non-small-cell lung cancer cells. Wang Q, Yang G, Jiang Y, Luo M, Li C, Zhao Y, Xie Y, Song K, Zhou J. Mol Carcinog. 2020 May;59(5):557-568.

  • Modulation of NMDA receptor by miR-219 in the amygdala and hippocampus of patients with mesial temporal lobe epilepsy. Hamamoto O, Tirapelli DPDC, Lizarte Neto FS, Freitas-Lima P, Saggioro FP, Cirino MLA, Assirati JA Jr, Serafini LN, Velasco TR, Sakamoto AC, Carlotti CG Jr. J Clin Neurosci. 2020 Apr;74:180-186.

  • HIF-1-miR-219-SMC4 Regulatory Pathway Promoting Proliferation and Migration of HCC under Hypoxic Condition. Chen Y, Huang F, Deng L, Yuan X, Tao Q, Wang T, Li D, Fan Y, Peng Q, Tang D. Biomed Res Int. 2019 Nov 7;2019:8983704.

  • miR-219 regulates liver cancer stem cell expansion via E-cadherin pathway. Si A, Wang L, Miao K, Zhang R, Ji H, Lei Z, Cheng Z, Fang X, Hao B. Cell Cycle. 2019 Dec;18(24):3550-3561.

  • MicroRNA-219a-5p suppresses intestinal inflammation through inhibiting Th1/Th17-mediated immune responses in inflammatory bowel disease. Shi Y, Dai S, Qiu C, Wang T, Zhou Y, Xue C, Yao J, Xu Y. Mucosal Immunol. 2020 Mar;13(2):303-312.

  • lncRNA CCAT1 contributes to the growth and invasion of gastric cancer via targeting miR-219-1. Li Y, Zhu G, Ma Y, Qu H. J Cell Biochem. 2019 Dec;120(12):19457-19468.

  • LncRNA HCP5 promotes triple negative breast cancer progression as a ceRNA to regulate BIRC3 by sponging miR-219a-5p. Wang L, Luan T, Zhou S, Lin J, Yang Y, Liu W, Tong X, Jiang W. Cancer Med. 2019 Aug;8(9):4389-4403.

  • lncRNA MEG3 modified epithelial-mesenchymal transition of ovarian cancer cells by sponging miR-219a-5p and regulating EGFR. Wang L, Yu M, Zhao S. J Cell Biochem. 2019 Oct;120(10):17709-17722.

  • Screening the expression of several miRNAs from TaqMan Low Density Array in traumatic brain injury: miR-219a-5p regulates neuronal apoptosis by modulating CCNA2 and CACUL1. Yan J, Bu X, Li Z, Wu J, Wang C, Li D, Song J, Wang J. J Neurochem. 2019 Jul;150(2):202-217.

    • There are 59 references associated with hsa-mir-219a-1. Click here to see the complete list in PubMed.