Precursor miRNA: hsa-mir-218-2

Precursor miRNA

Precursor Name hsa-mir-218-2
Genomic Location chr5:168768146-168768255 (-); nearby genomic features
NCBI GENE ID 407001
MIM ID 616771
miRBase ID MI0000295
Precursor Sequence 
gac   --uc  u    g       uuu         cu        gguggaacga  g
   cag    gc gcgg gcuuucc   gugcuugau  aaccaugu          ug a
   |||    || |||| |||||||   |||||||||  ||||||||          || 
   guc    cg ugcc cgaaagg   cacgaacug  uugguaca          gc a
-ac   cucu  -    a       cgc         uc        --------ag  a

Mature miRNA

Mature Name hsa-miR-218-5p
Previous Name hsa-miR-218
Mature Sequence 5' - uugugcuugaucuaaccaugu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000275

References

  • MECHANISM OF MICRORNA-218-5P IN MITOCHONDRIAL BIOGENESIS OF SEPSIS-INDUCED ACUTE KIDNEY INJURY BY THE REGULATION OF PGC-1Α. Kuang J, Fang J, Hu S, Yang X, Fan X. Shock. 2024 Sep 1;62(3):426-436.

  • HK2 and LDHA upregulation mediate hexavalent chromium-induced carcinogenesis, cancer development and prognosis through miR-218 inhibition. Wang L, Zhang RK, Sang P, Xie YX, Zhang Y, Zhou ZH, Wang KK, Zhou FM, Ji XB, Liu WJ, Qiu JG, Jiang BH. Ecotoxicol Environ Saf. 2024 Jul 1;279:116500.

  • Effect of circFOXM1/miR-218-5p on the proliferation, apoptosis and migration of glioma cells. Deng R, Chen J, Qin J, Wang L, Zhu D, Sun X. Cell Mol Biol (Noisy-le-grand). 2024 Apr 28;70(4):191-195.

  • SNAI2/FTH1P3/miR-218-5p Positive Feedback Loop Promotes Colorectal Cancer Metastasis. Deng H, Zhang Q, Zhao Z, Wang M, Xu Q. Biochem Genet. 2024 Jun;62(3):2210-2223.

  • MicroRNA-218-5p regulates inflammation response via targeting TLR4 in atherosclerosis. Chen J, Tang Z, Chen Z, Wei Y, Liang H, Zhang X, Gao Z, Zhu H. BMC Cardiovasc Disord. 2023 Mar 8;23(1):122.

  • CircRNA-104718 promotes glioma malignancy through regulation of miR-218-5p/HMGB1 signalling pathway. Yan Y, Wang H, Hu J, Guo T, Dong Q, Yin H, Yuan G, Pan Y. Metab Brain Dis. 2023 Jun;38(5):1531-1542.

  • MiR-218 Targeted Regulation of Robol Expression Regulates Proliferation, Invasion and Migration of Glioma Cells. Zhang R, Jiang W, Liu Z, Hou P, Zhang S. Cell Mol Biol (Noisy-le-grand). 2022 May 31;68(5):202-206.

  • LncRNA Nian R, Li W, Li X, Zhang J, Li W, Pan F, Cheng J, Jin X. Arch Endocrinol Metab. 2023 Jan 18;67(1):55-63.

  • LncRNA LINC00511 promotes COL1A1-mediated proliferation and metastasis by sponging miR-126-5p/miR-218-5p in lung adenocarcinoma. Wang Y, Mei X, Song W, Wang C, Qiu X. BMC Pulm Med. 2022 Jul 16;22(1):272.

  • miR-218 affects the ECM composition and cell biomechanical properties of glioblastoma cells. Grabowska M, KuczyÅ„ski K, Piwecka M, Rabiasz A, ZemÅ‚a J, GÅ‚odowicz P, Wawrzyniak D, Lekka M, Rolle K. J Cell Mol Med. 2022 Jul;26(14):3913-3930.

  • The role of circulating miRNAs in leptin resistance in obese children. Altınkılıç EM, Bayrakdar S, Seymen Karabulut G, HaliloÄŸlu B, Attar R. J Pediatr Endocrinol Metab. 2022 Apr 22;35(6):761-766.

  • Genetic Polymorphism of miR-218-2 (rs11134527) in Cervical Cancer: A Case-Control Study on the Bangladeshi Women. Nazneen F, Millat MS, Barek MA, Aziz MA, Uddin MS, Jafrin S, Aka TD, Islam MS. Microrna. 2021;10(3):219-224.

  • Long non-coding RNA HOXA-AS3 promotes cell proliferation of oral squamous cell carcinoma through sponging microRNA miR-218-5p. Zhao Y, Yao R. Bioengineered. 2021 Dec;12(1):8724-8737.

  • MicroRNA‑218 inhibits the malignant phenotypes of glioma by modulating the TNC/AKT/AP‑1/TGFβ1 feedback signaling loop. Dang S, Zhang R, Tian S, Hou P, Li G, Ji M. Int J Mol Med. 2021 Nov;48(5):205.

  • LncRNA CCAT1 sponges miR-218-5p to promote EMT, cellular migration and invasion of retinoblastoma by targeting MTF2. Meng X, Zhang Y, Hu Y, Zhong J, Jiang C, Zhang H. Cell Signal. 2021 Oct;86:110088.

  • Circ_0003998 enhances doxorubicin resistance in hepatocellular carcinoma by regulating miR-218-5p/EIF5A2 pathway. Li X, He J, Ren X, Zhao H, Zhao H. Diagn Pathol. 2020 Dec 11;15(1):141.

  • Effects and mechanism of microRNA‑218 against lung cancer. Chen Y, Yang JL, Xue ZZ, Cai QC, Hou C, Li HJ, Zhao LX, Zhang Y, Gao CW, Cong L, Wang TZ, Chen DM, Li GS, Luo SQ, Yao Q, Yang CJ, Zhu QS, Cao CH. Mol Med Rep. 2021 Jan;23(1):28.

  • Investigating aberrantly expressed microRNAs in peripheral blood mononuclear cells from patients with treatment‑resistant schizophrenia using miRNA sequencing and integrated bioinformatics. You X, Zhang Y, Long Q, Liu Z, Ma X, Lu Z, Yang W, Feng Z, Zhang W, Teng Z, Zeng Y. Mol Med Rep. 2020 Nov;22(5):4340-4350.

  • [MiR-218 Targeting Bmi-1 Inhibits Proliferation of Acute Promyelocytic Leukemia Cells]. Liu JF, He P, Pan DF. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2020 Jun;28(3):815-820.

  • The miR-218/GAB2 axis regulates proliferation, invasion and EMT via the PI3K/AKT/GSK-3β pathway in prostate cancer. Tian J, Zhang H, Mu L, Wang M, Li X, Zhang X, Xie E, Ma M, Wu D, Du Y. Exp Cell Res. 2020 Sep 1;394(1):112128.

    • There are 86 references associated with hsa-mir-218-2. Click here to see the complete list in PubMed.