Precursor miRNA: hsa-mir-199a-1

Precursor miRNA

Precursor Name hsa-mir-199a-1
Genomic Location chr19:10817426-10817496 (-); nearby genomic features
NCBI GENE ID 406976
MIM ID 610719
miRBase ID MI0000242
Precursor Sequence 
   aac       u        c   u  ---g   
gcc   ccagugu cagacuac ugu ca    gagg
|||   ||||||| |||||||| ||| ||    ||| c
cgg   gguuaca gucugaug aca gu    cucu
   auu       c        -   u  guaa

Mature miRNA

Mature Name hsa-miR-199a-3p
Previous Name hsa-miR-199a*
Mature Sequence 5' - acaguagucugcacauugguua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000232
Similar miRNAs hsa-miR-199b-3p, hsa-miR-3129-5p (sharing the same seed sequence with hsa-miR-199a-3p).

References

  • MiR-199a-3p regulates HCT-8 cell autophagy and apoptosis in response to Cryptosporidium parvum infection by targeting MTOR. Wu S, Shao T, Xie J, Li J, Sun L, Zhang Y, Zhao L, Wang L, Li X, Zhang L, Wang R. Commun Biol. 2024 Jul 31;7(1):924.

  • miR-199a-5p modulates choroidal neovascularization by regulating Wnt7b/Wnt/β-catenin signaling pathway. Geng Y, Hua H, Xia Y, Zhou J, He J, Xu X, Zhao J. J Mol Histol. 2024 Jun;55(3):359-370.

  • Alternative splicing-related long noncoding RNA ANRIL facilitates hepatocellular carcinoma by targeting the miR-199a-5p/SRSF1 axis and impacting Anillin. Zhang Y, Lu Y, Wang N, Yang Y, Hao F, Fei X, Chen Y, Wang J. Mol Carcinog. 2024 Jun;63(6):1064-1078.

  • miR-199a/b-3p inhibits HCC cell proliferation and invasion through a novel compensatory signaling pathway DJ-1\Ras\PI3K/AKT. Ma LN, Wu LN, Liu SW, Zhang X, Luo X, Nawaz S, Ma ZM, Ding XC. Sci Rep. 2024 Jan 2;14(1):224.

  • M2 Macrophage-Derived Exosomes Regulate miR-199a-3p Promoter Methylation Through the LINC00470-Mediated myc/DNMT3a Axis to Promote Breast Cancer Development. Ma D, Wu J, Chen C, Niu Y, Ji K, Xiao Y, Guan Q. Biochem Genet. 2024 Jun;62(3):2082-2099.

  • MicroRNA-199a-3p suppresses the invasion and metastasis of nasopharyngeal carcinoma through SCD1/PTEN/AKT signaling pathway. Hu W, Wang Y, Zhang Q, Luo Q, Huang N, Chen R, Tang X, Li X, Luo H. Cell Signal. 2023 Oct;110:110833.

  • HMSCs exosome-derived miR-199a-5p attenuates sulfur mustard-associated oxidative stress via the CAV1/NRF2 signalling pathway. Gong C, Gu Z, Zhang X, Xu Q, Mao G, Pei Z, Meng W, Cen J, Liu J, He X, Sun M, Xiao K. J Cell Mol Med. 2023 Aug;27(15):2165-2182.

  • MiR-199a-5p-Regulated SMARCA4 Promotes Oral Squamous Cell Carcinoma Tumorigenesis. Xu M, Zhang J, Lu X, Liu F, Shi S, Deng X. Int J Mol Sci. 2023 Mar 1;24(5):4756.

  • Dysregulation of Long Noncoding RNA NEAT1/miR-199a-5/BiP Axis in Patients with Diabetic Neuropathy. Hassani SS, Karamali N, Rajabinejad M, Ashjari D, Afshar Hezarkhani L, Gorgin Karaji A, Salari F, Rezaiemanesh A. Lab Med. 2023 Mar 7;54(2):160-165.

  • miR-199a Is Upregulated in GDM Targeting the MeCP2-Trpc3 Pathway. Guan CY, Cao JL, Zhang L, Wang XQ, Ma X, Xia HF. Front Endocrinol (Lausanne). 2022 Jul 14;13:917386.

  • miR-199a-3p/5p regulate tumorgenesis via targeting Rheb in non-small cell lung cancer. Liu X, Wang X, Chai B, Wu Z, Gu Z, Zou H, Zhang H, Li Y, Sun Q, Fang W, Ma Z. Int J Biol Sci. 2022 Jun 27;18(10):4187-4202.

  • Expression profiles of miR3181 and miR199a in plasma and placenta of virally suppressed HIV-1 infected Cameroonian pregnant women at delivery. Esemu LF, Awanakam H, Nanfa D, Besong M, Tsayem I, Nkenfou CN, Bigoga J, Leke R, Eugene S, Ndhlovu LC, Loni GE. PLoS One. 2022 May 20;17(5):e0268820.

  • MiR-199a-3p Overexpression Suppressed Cell Proliferation and Sensitized Chronic Myeloid Leukaemia Cells to Imatinib by Inhibiting mTOR Signalling. Liu X, Cui MM, Zhu HZ, Fu PY, Wang GC, Huang L. Acta Haematol. 2022;145(5):484-498.

  • A Description of the Hemolytic Component in Sickle Leg Ulcer: The Role of Circulating miR-199a-5p, miR-144, and miR-126. Santos EDC, Melo GIV, Santana PVB, Quadros IGS, Yahouédéhou SCMA, Guarda CCD, Santiago RP, Fiuza LM, Carvalho SP, Adorno EV, Kaneto CM, Fonseca TCC, Goncalves MS, Aleluia MM. Biomolecules. 2022 Feb 17;12(2):317.

  • MicroRNA-199a deficiency relates to higher bone marrow blasts, poor risk stratification and worse prognostication in pediatric acute myeloid leukemia patients. Qi X, Zhang Y. Pediatr Hematol Oncol. 2022 Sep;39(6):500-507.

  • Identification of Tanaka N, Minemura C, Asai S, Kikkawa N, Kinoshita T, Oshima S, Koma A, Kasamatsu A, Hanazawa T, Uzawa K, Seki N. Genes (Basel). 2021 Nov 27;12(12):1910.

  • miR-199a Targeting PNRC1 to Promote Keratinocyte Proliferation and Invasion in Cholesteatoma. Yao L, Zhang W, Zheng J, Lu X, Zhang F. Biomed Res Int. 2021 Nov 16;2021:1442093.

  • Clinical value of lncRNA TUG1 in temporal lobe epilepsy and its role in the proliferation of hippocampus neuron via sponging miR-199a-3p. Li C, Zheng X, Liu P, Li M. Bioengineered. 2021 Dec;12(2):10666-10673.

  • Long non-coding RNA TTN-AS1/microRNA-199a-3p/runt-related transcription factor 1 gene axis regulates the progression of oral squamous cell carcinoma. Jin Z, Jiang S. Bioengineered. 2021 Dec;12(1):7724-7736.

  • Identification of miR-199a-5p, miR-214-3p and miR-99b-5p as Fibrosis-Specific Extracellular Biomarkers and Promoters of HSC Activation. Messner CJ, Schmidt S, Özkul D, Gaiser C, Terracciano L, Krähenbühl S, Suter-Dick L. Int J Mol Sci. 2021 Sep 10;22(18):9799.

    • There are 213 references associated with hsa-mir-199a-1. Click here to see the complete list in PubMed.