Precursor miRNA: hsa-mir-187

Precursor miRNA

Precursor Name hsa-mir-187
Genomic Location chr18:35904818-35904926 (-); nearby genomic features
NCBI GENE ID 406963
MIM ID 612698
miRBase ID MI0000274
Precursor Sequence 
g u      caccaugacacag    aga    g    a           c  -  c - ug
 g cgggcu             ugug   ccuc ggcu caacacaggac cg gg g c  c
 | ||||||             ||||   |||| |||| ||||||||||| || || | |  
 c gccugg             acgc   ggag ccga guuguguucug gc cc c g  u
a -      -------------    -ag    g    c           u  u  c a uc

Mature miRNA

Mature Name hsa-miR-187-3p
Previous Name hsa-miR-187
Mature Sequence 5' - ucgugucuuguguugcagccgg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000262

References

  • Long noncoding RNA VPS9D1-AS1 promotes the progression of endometrial cancer via regulation of the miR-187-3p/S100A4 axis. Ren W, Ouyang L. Environ Toxicol. 2024 Sep;39(9):4447-4458.

  • circ-Iqsec1 induces bone marrow-derived mesenchymal stem cell (BMSC) osteogenic differentiation through the miR-187-3p/Satb2 signaling pathway. Fan L, Yang K, Yu R, Hui H, Wu W. Arthritis Res Ther. 2022 Dec 14;24(1):273.

  • Suppressive function of bone marrow-derived mesenchymal stem cell-derived exosomal microRNA-187 in prostate cancer. Li C, Sun Z, Song Y, Zhang Y. Cancer Biol Ther. 2022 Dec 31;23(1):1-14.

  • High Levels of Tumor miR-187-3p-A Potential Tumor-Suppressor microRNA-Are Correlated with Poor Prognosis in Colorectal Cancer. Ng L, Wan TM, Iyer DN, Huang Z, Sin RW, Man AT, Li X, Foo DC, Lo OS, Law WL. Cells. 2022 Aug 5;11(15):2421.

  • Association of miR-155, miR-187 and Inflammatory Cytokines IL-6, IL-10 and TNF-α in Chronic Opium Abusers. Purohit P, Roy D, Dwivedi S, Nebhinani N, Sharma P. Inflammation. 2022 Apr;45(2):554-566.

  • MiR-187 regulates the proliferation, migration and invasion of human trophoblast cells by repressing BCL6-mediated activation of PI3K/AKT signaling. Chen X, Song QL, Ji R, Wang JY, Li ZH, Guo D, Yin TL, Wang SJ, Yang J. Placenta. 2022 Feb;118:20-31.

  • Cyclic tensile strain facilitates proliferation and migration of human aortic smooth muscle cells and reduces their apoptosis via miRNA-187-3p. Yang D, Wei GY, Li M, Peng MS, Sun Y, Zhang YL, Lu C, Qing KX, Cai HB. Bioengineered. 2021 Dec;12(2):11439-11450.

  • A clinical and in-silico study exploring the association of CASP-3, NF-kB, miR-187, and miR-146 in pre-eclampsia. Sharma C, Purohit P, Khokhar M, Modi A, Singh P, Shekhar S, Sharma S, Gothwal M, Sharma P. Hypertens Pregnancy. 2021 Nov;40(4):288-302.

  • Expression of miR-187 and miR-509-3p in serum of primary hepatocellular carcinoma patients and its evaluation of prognosis. Dai G, Shen S, Liu Y, Ma X, Fang Y, Weng Y, Li C. J BUON. 2021 Jul-Aug;26(4):1340-1345.

  • CXCR5 induces perineural invasion of salivary adenoid cystic carcinoma by inhibiting microRNA-187. Zhang M, Wu JS, Xian HC, Chen BJ, Wang HF, Yu XH, Pang X, Dai L, Jiang J, Liang XH, Tang YL. Aging (Albany NY). 2021 Jun 10;13(11):15384-15399.

  • Long non-coding RNA TUG1/microRNA-187-3p/TESC axis modulates progression of pituitary adenoma via regulating the NF-κB signaling pathway. Zhang R, Yang F, Fan H, Wang H, Wang Q, Yang J, Song T. Cell Death Dis. 2021 May 21;12(6):524.

  • circCCND1 Regulates Oxidative Stress and FGF9 to Enhance Chemoresistance of Non-Small Cell Lung Cancer via Sponging miR-187-3p. Geng J, Yang K. DNA Cell Biol. 2021 May;40(5):675-682.

  • The miR-187 induced bone reconstruction and healing in a mouse model of osteoporosis, and accelerated osteoblastic differentiation of human multipotent stromal cells by targeting BARX2. Zhang J, Zhang T, Tang B, Li J, Zha Z. Pathol Res Pract. 2021 Mar;219:153340.

  • CircRNA hsa_circRNA_104348 promotes hepatocellular carcinoma progression through modulating miR-187-3p/RTKN2 axis and activating Wnt/β-catenin pathway. Huang G, Liang M, Liu H, Huang J, Li P, Wang C, Zhang Y, Lin Y, Jiang X. Cell Death Dis. 2020 Dec 14;11(12):1065.

  • MicroRNA-187 suppresses the proliferation migration and invasion of human osteosarcoma cells by targeting MAPK7. Liu M, Wu L, Cai C, Liu L, Xu Y. J BUON. 2020 Jan-Feb;25(1):472-478.

  • Role of miRNA-182 and miRNA-187 as potential biomarkers in prostate cancer and its correlation with the staging of prostate cancer. Nayak B, Khan N, Garg H, Rustagi Y, Singh P, Seth A, Dinda AK, Kaushal S. Int Braz J Urol. 2020 Jul-Aug;46(4):614-623.

  • Expression profiles of miRNAs in giant cell tumor of bone showed miR-187-5p and miR-1323 can regulate biological functions through inhibiting FRS2. Jin Y, Zhang J, Zhu H, Fan G, Zhou G. Cancer Med. 2020 May;9(9):3163-3173.

  • miR-187 Hung PS, Chuang FJ, Chen CY, Chou CH, Tu HF, Lo SS. Anticancer Res. 2020 Mar;40(3):1427-1436.

  • MiR-187 suppresses non-small-cell lung cancer cell proliferation by targeting FGF9. Liang Z, Xu J, Ma Z, Li G, Zhu W. Bioengineered. 2020 Dec;11(1):70-80.

  • Over-expression of miR-187 inhibited cell proliferation and metastasis of glioma via down-regulating SMAD1. Gulinaer AJ, Ju AN, Gao M, Luo Y, Bo YL. Eur Rev Med Pharmacol Sci. 2019 Dec;23(24):10908-10917.

    • There are 51 references associated with hsa-mir-187. Click here to see the complete list in PubMed.