Precursor miRNA: hsa-mir-139

Precursor miRNA

Precursor Name hsa-mir-139
Genomic Location chr11:72615063-72615130 (-); nearby genomic features
NCBI GENE ID 406931
MIM ID 615017
miRBase ID MI0000261
Precursor Sequence 
gug       -   u  a            g gg
   uauucua cag gc cgugucuccagu u  c
   ||||||| ||| || |||||||||||| |   u
   augaggu guc cg gcgcagaggucg a  c
-ca       u   c  -            g gg

Mature miRNA

Mature Name hsa-miR-139-5p
Previous Name hsa-miR-139
Mature Sequence 5' - ucuacagugcacgugucuccagu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000250

Mature miRNA

Mature Name hsa-miR-139-3p
Mature Sequence 5' - uggagacgcggcccuguuggagu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004552

References

  • KLF7 enhances the invasion and migration of colorectal cancer cells via the miR-139-5p/TPD52 axis. Zhang J, Li Z, Han J, Tian Z, Meng Q, Niu W. Cancer Biol Ther. 2024 Dec 31;25(1):2385172.

  • The novel circ_0004674/miR-139-5p/ZBTB2 regulatory cascade inhibits the development of oral squamous cell carcinoma. Qi C, Zhang L, Wang W. Head Neck. 2024 Jul;46(7):1671-1682.

  • Circulating microvesicles miR139-3p from bronchopulmonary dysplasia aggravates pulmonary vascular simplification by targeting 4E binding protein 1. Yu L, He R, Liu C, Shi Y, Wang D. J Gene Med. 2024 Feb;26(2):e3675.

  • EZH2-H3K27me3-mediated silencing of mir-139-5p inhibits cellular senescence in hepatocellular carcinoma by activating TOP2A. Wang K, Jiang X, Jiang Y, Liu J, Du Y, Zhang Z, Li Y, Zhao X, Li J, Zhang R. J Exp Clin Cancer Res. 2023 Nov 27;42(1):320.

  • MicroRNA-139-5p suppresses non-small cell lung cancer progression by targeting ATAD2. Sun T, Liu Z. Pathol Res Pract. 2023 Sep;249:154719.

  • LncRNA AC012360.1 facilitates growth and metastasis by regulating the miR-139-5p/LPCAT1 axis in hepatocellular carcinoma. Zhao Y, Liu Y, Shi X. Environ Toxicol. 2023 Sep;38(9):2192-2203.

  • Tumor-suppressive role of miR-139-5p in angiogenesis and tumorigenesis of ovarian cancer: Based on GEO microarray analysis and experimental validation. Tan S, Chen X, Liu W. Cell Signal. 2023 Sep;109:110730.

  • FTO-stabilized miR-139-5p targets ZNF217 to suppress prostate cancer cell malignancies by inactivating the PI3K/Akt/mTOR signal pathway. Azhati B, Reheman A, Dilixiati D, Rexiati M. Arch Biochem Biophys. 2023 Jun;741:109604.

  • miR-139-3p/Wnt5A Axis Inhibits Metastasis in Hepatoblastoma. Wu Z, Chen S, Zuo T, Fu J, Gong J, Liu D, Wang B. Mol Biotechnol. 2023 Dec;65(12):2030-2037.

  • The Potential Role of MiRs-139-5p and -454-3p in Endoglin-Knockdown-Induced Angiogenic Dysfunction in HUVECs. Cannavicci A, Zhang Q, Kutryk MJB. Int J Mol Sci. 2023 Mar 3;24(5):4916.

  • MiR-139 Affects Radioresistance in Esophageal Cancer by Targeting the PDK1/AKT/Cyclin D1 Signaling Pathway. Liu Y, Liu Y, Jiao WP. Bull Exp Biol Med. 2023 Feb;174(4):489-496.

  • Circ_0068631 sponges miR-139-5p to promote the growth and metastasis of cutaneous squamous cell carcinoma by upregulating HOXB7. Ji J, Xiong C, Peng J, Zhang N, Zhang Y, Yang H, Zhu W. Skin Res Technol. 2023 Feb;29(2):e13248.

  • CircNDC80 promotes glioblastoma multiforme tumorigenesis via the miR-139-5p/ECE1 pathway. Wang Y, Wang B, Zhou F, Lv K, Xu X, Cao W. J Transl Med. 2023 Jan 12;21(1):22.

  • Molecular Pathogenesis of Colorectal Cancer: Impact of Oncogenic Targets Regulated by Tumor Suppressive Yasudome R, Seki N, Asai S, Goto Y, Kita Y, Hozaka Y, Wada M, Tanabe K, Idichi T, Mori S, Ohtsuka T. Int J Mol Sci. 2022 Oct 1;23(19):11616.

  • Circ_0077109 sponges miR-139-5p and upregulates HOXD10 in trophoblast cells as potential mechanism for preeclampsia progression. Zhang L, Liu M. Am J Reprod Immunol. 2022 Nov;88(5):e13609.

  • LncRNA RP11‑805J14.5 functions as a ceRNA to regulate CCND2 by sponging miR‑34b‑3p and miR‑139‑5p in lung adenocarcinoma. Zhu H, Xu X, Zheng E, Ni J, Jiang X, Yang M, Zhao G. Oncol Rep. 2022 Sep;48(3):161.

  • Tumor suppressive role of microRNA-139-5p in bone marrow mesenchymal stem cells-derived extracellular vesicles in bladder cancer through regulation of the KIF3A/p21 axis. Xiang Y, Lv D, Song T, Niu C, Wang Y. Cell Death Dis. 2022 Jul 12;13(7):599.

  • MicroRNA-139-5p acts as a suppressor gene for depression by targeting nuclear receptor subfamily 3, group C, member 1. Su B, Cheng S, Wang L, Wang B. Bioengineered. 2022 May;13(5):11856-11866.

  • CBX3 regulated by miR-139 promotes the development of HCC by regulating cell cycle progression. Zhang P, Yang X, Zha Z, Zhu Y, Zhang G, Li G. Cell Cycle. 2022 Aug;21(16):1740-1752.

  • Circular RNA circ_0002594 regulates PDGF-BB-induced proliferation and migration of human airway smooth muscle cells via sponging miR-139-5p/TRIM8 in asthma. Quan L, Ren G, Liu L, Huang W, Li M. Autoimmunity. 2022 Aug;55(5):339-350.

    • There are 195 references associated with hsa-mir-139. Click here to see the complete list in PubMed.