Precursor miRNA: hsa-mir-124-2

Precursor miRNA

Precursor Name hsa-mir-124-2
Genomic Location chr8:64379149-64379257 (+); nearby genomic features
NCBI GENE ID 406908
miRBase ID MI0000444
Precursor Sequence 
a     au   ----            cc        a   ga        uaau
 ucaag  uag    aggcucugcucu  guguucac gcg  ccuugauu    g
 |||||  |||    ||||||||||||  |||||||| |||  ||||||||     u
 aguuc  guc    uccgaggcgaga  cguaagug cgc  ggaauuaa    c
a     ac   ggca            ac        g   ac        caua

Mature miRNA

Mature Name hsa-miR-124-3p
Previous Name hsa-miR-124a;hsa-miR-124
Mature Sequence 5' - uaaggcacgcggugaaugccaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000422
Similar miRNAs hsa-miR-506-3p (sharing the same seed sequence with hsa-miR-124-3p).

References

  • miR-124-3p and miR-194-5p regulation of the PI3K/AKT pathway via ROR2 in medulloblastoma progression. Wang C, Fu R, Wang Y, Wei J, Yu Y, Hu L, Zhang C. Cancer Gene Ther. 2024 Jun;31(6):941-954.

  • MicroRNA-124 influenced depressive symptoms via large-scale brain connectivity in major depressive disorder patients. He C, Wang Q, Fan D, Liu X, Bai Y, Zhang H, Zhang H, Yao H, Zhang Z, Xie C. Asian J Psychiatr. 2024 May;95:104025.

  • MiR-124-3p negatively impacts embryo implantation via suppressing uterine receptivity formation and embryo development. Yao K, Kang Q, Chen K, Shi B, Jin X. Reprod Biol Endocrinol. 2024 Jan 31;22(1):16.

  • Knockdown of lncRNA MALAT1 attenuates renal interstitial fibrosis through miR-124-3p/ITGB1 axis. Xia W, Chen X, Zhu Z, Chen H, Li B, Wang K, Huang L, Liu Z, Chen Z. Sci Rep. 2023 Oct 23;13(1):18076.

  • MALAT1 as a potential salivary biomarker in oral squamous cell carcinoma through targeting miRNA-124. Shalaby R, Ibrahim S, Kotb AAW, Baz S, Hafed L, Shaker O, Afifi S. Oral Dis. 2024 May;30(4):2075-2083.

  • FAM19A4/miR124-2 Methylation Testing and Human Papillomavirus (HPV) 16/18 Genotyping in HPV-Positive Women Under the Age of 30 Years. Vink FJ, Meijer CJLM, Hesselink AT, Floore AN, Lissenberg-Witte BI, Bonde JH, Pedersen H, Cuschieri K, Bhatia R, Poljak M, OÅ¡trbenk Valenčak A, Hillemanns P, Quint WGV, Del Pino M, Kenter GG, Steenbergen RDM, Heideman DAM, Bleeker MCG. Clin Infect Dis. 2023 Feb 8;76(3):e827-e834.

  • Clinical Regression of High-Grade Cervical Intraepithelial Neoplasia Is Associated With Absence of Kremer WW, Dick S, Heideman DAM, Steenbergen RDM, Bleeker MCG, Verhoeve HR, van Baal WM, van Trommel N, Kenter GG, Meijer CJLM, Berkhof J. J Clin Oncol. 2022 Sep 10;40(26):3037-3046.

  • Genome-wide methylation analyses identifies Non-coding RNA genes dysregulated in breast tumours that metastasise to the brain. Pangeni RP, Olivaries I, Huen D, Buzatto VC, Dawson TP, Ashton KM, Davis C, Brodbelt AR, Jenkinson MD, Bièche I, Yang L, Latif F, Darling JL, Warr TJ, Morris MR. Sci Rep. 2022 Jan 20;12(1):1102.

  • Risk-stratification of HPV-positive women with low-grade cytology by FAM19A4/miR124-2 methylation and HPV genotyping. Dick S, Vink FJ, Heideman DAM, Lissenberg-Witte BI, Meijer CJLM, Berkhof J. Br J Cancer. 2022 Feb;126(2):259-264.

  • MicroRNA-124 acts as a positive regulator of IFN-β signaling in the lipopolysaccharide-stimulated human microglial cells. PajarskienÄ— J, KaÅ¡Ä—ta V, VaikÅ¡noraitÄ— K, Tunaitis V, PivoriÅ«nas A. Int Immunopharmacol. 2021 Dec;101(Pt A):108262.

  • The Effect and Potential Mechanism of microRNA-124 on the Biological Behavior of Colon Cancer Cells. Zhou G. Ann Clin Lab Sci. 2021 Sep;51(5):646-653.

  • MiR-124-3p Suppresses Prostatic Carcinoma by Targeting PTGS2 Through the AKT/NF-κB Pathway. Zhang Z. Mol Biotechnol. 2021 Jul;63(7):621-630.

  • MicroRNA-124-3p suppresses PD-L1 expression and inhibits tumorigenesis of colorectal cancer cells via modulating STAT3 signaling. Roshani Asl E, Rasmi Y, Baradaran B. J Cell Physiol. 2021 Oct;236(10):7071-7087.

  • MicroRNA-124 inhibits hepatic stellate cells inflammatory cytokines secretion by targeting IQGAP1 through NF-κB pathway. Yang J, Xu C, Wu M, Wu Y, Jia X, Zhou C, Zhang X, Ge S, Li Z, Zhang L. Int Immunopharmacol. 2021 Jun;95:107520.

  • miR-124-3p combined with miR-506-3p delay hepatic carcinogenesis via modulating sirtuin 1. Xiang H, Luo M, Hou P, Xiao Z, Huang Z, Feng Q, Zhang R, Li Y, Wu L. Biomarkers. 2021 May;26(3):196-206.

  • [Novel miRNAs as Potential Regulators of PD-1/PD-L1 Immune Checkpoint, and Prognostic Value of MIR9-1 and MIR124-2 Methylation in Ovarian Cancer]. Kushlinskii NE, Loginov VI, Utkin DO, Filippova EA, Burdennyy AM, Korotkova EA, Pronina IV, Lukina SS, Smirnova AV, Gershtein ES, Braga EA. Mol Biol (Mosk). 2020 Nov-Dec;54(6):990-996.

  • Methylation markers FAM19A4 and miR124-2 as triage strategy for primary human papillomavirus screen positive women: A large European multicenter study. Bonde J, Floore A, Ejegod D, Vink FJ, Hesselink A, van de Ven PM, Valenčak AO, Pedersen H, Doorn S, Quint WG, Petry KU, Poljak M, Stanczuk G, Cuschieri K, de Sanjosé S, Bleeker M, Berkhof J, Meijer CJLM, Heideman DAM. Int J Cancer. 2021 Jan 15;148(2):396-405.

  • Cocaine-regulated microRNA miR-124 controls poly (ADP-ribose) polymerase-1 expression in neuronal cells. Dash S, Balasubramaniam M, Martínez-Rivera FJ, Godino A, Peck EG, Patnaik S, Suar M, Calipari ES, Nestler EJ, Villalta F, Dash C, Pandhare J. Sci Rep. 2020 Jul 8;10(1):11197.

  • Decreased miR-124 contributes to the epithelial-mesenchymal transition phenotype formation of lung adenocarcinoma cells via targeting enhancer of zeste homolog 2. Wu J, Li L, Zhang Y, Zhu J. Pathol Res Pract. 2020 Jun;216(6):152976.

  • Expression of p16 and HPV E4 on biopsy samples and methylation of FAM19A4 and miR124-2 on cervical cytology samples in the classification of cervical squamous intraepithelial lesions. Leeman A, Jenkins D, Del Pino M, Ordi J, Torné A, Doorbar J, Meijer CJLM, van Kemenade FJ, Quint WGV. Cancer Med. 2020 Apr;9(7):2454-2461.

    • There are 106 references associated with hsa-mir-124-2. Click here to see the complete list in PubMed.