Mature miRNA: mmu-miR-672-5p

Mature miRNA

miRNA Name mmu-miR-672-5p
Previous Name mmu-miR-672
miRNA Sequence 5' - ugagguugguguacuguguguga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003735
Similar miRNAs mmu-miR-377-5p (sharing the same seed sequence with mmu-miR-672-5p).

Precursor miRNA

Precursor Name mmu-mir-672
Genomic Location chrX:104116175-104116274 (-); nearby genomic features
NCBI GENE ID 751535
miRBase ID MI0004258
Precursor Sequence 
    g  aucua      u g        u     u           guaua
gaug ug     gcccuu a uuuugagg uggug acuguguguga     c
|||| ||     |||||| | |||||||| ||||| |||||||||||      a
cuac ac     ugggag u aaagcuuc aucac ugacacacacu     u
    -  ----g      - g        u     -           auuua

References

  • Cerebral endothelial cell-derived extracellular vesicles regulate microglial polarization and promote autophagy via delivery of miR-672-5p. Wang C, Feng L, Zhu L, Wu L, Chen B, Cui C, Yang M, Gao Y, Jiang P. Cell Death Dis. 2023 Sep 29;14(9):643.

  • Exosome-Shuttled miR-672-5p from Anti-Inflammatory Microglia Repair Traumatic Spinal Cord Injury by Inhibiting AIM2/ASC/Caspase-1 Signaling Pathway Mediated Neuronal Pyroptosis. Zhou Z, Li C, Bao T, Zhao X, Xiong W, Luo C, Yin G, Fan J. J Neurotrauma. 2022 Aug;39(15-16):1057-1074.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • A microRNA (mmu-miR-124) prevents Sox9 expression in developing mouse ovarian cells. Real FM, Sekido R, Lupiáñez DG, Lovell-Badge R, Jiménez R, Burgos M. Biol Reprod. 2013 Oct 4;89(4):78.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Species-specific microRNA roles elucidated following astrocyte activation. Mor E, Cabilly Y, Goldshmit Y, Zalts H, Modai S, Edry L, Elroy-Stein O, Shomron N. Nucleic Acids Res. 2011 May;39(9):3710-23.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Suppression of LPS-induced Interferon-gamma and nitric oxide in splenic lymphocytes by select estrogen-regulated microRNAs: a novel mechanism of immune modulation. Dai R, Phillips RA, Zhang Y, Khan D, Crasta O, Ahmed SA. Blood. 2008 Dec 1;112(12):4591-7.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E. Genome Res. 2006 Oct;16(10):1289-98.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.