Mature miRNA: mmu-miR-421-3p

Mature miRNA

miRNA Name mmu-miR-421-3p
Previous Name mmu-miR-421
miRNA Sequence 5' - aucaacagacauuaauugggcgc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004869

Precursor miRNA

Precursor Name mmu-mir-421
Genomic Location chrX:103572921-103572996 (-); nearby genomic features
Clustered miRNAs mmu-mir-421,mmu-mir-374b,mmu-mir-374c (within 10kb in genome)
NCBI GENE ID 100124494
miRBase ID MI0005496
Precursor Sequence 
-  uu      -    uua            a   aaa
 ca  guaggc cuca   aauguuuguuga uga   a
 ||  |||||| ||||   |||||||||||| |||    a
 gu  cguccg gggu   uuacagacaacu acu   u
u  cu      c    uaa            -   aag

References

  • MicroRNA‑421 attenuates macrophage‑mediated inflammation by inhibiting PDCD4 Liu H, Sun J, Gao L, Fan L, Chen D, Wu L. Mol Med Rep. 2021 Jul;24(1):527.

  • MiR-421 Aggravates Neurotoxicity and Promotes Cell Death in Parkinson's Disease Models by Directly Targeting MEF2D. Dong Y, Xiong J, Ji L, Xue X. Neurochem Res. 2021 Feb;46(2):299-308.

  • CircPAN3 ameliorates myocardial ischaemia/reperfusion injury by targeting miR-421/Pink1 axis-mediated autophagy suppression. Zhang CL, Long TY, Bi SS, Sheikh SA, Li F. Lab Invest. 2021 Jan;101(1):89-103.

  • microRNA-421-3p prevents inflammatory response in cerebral ischemia/reperfusion injury through targeting m6A Reader YTHDF1 to inhibit p65 mRNA translation. Zheng L, Tang X, Lu M, Sun S, Xie S, Cai J, Zan J. Int Immunopharmacol. 2020 Nov;88:106937.

  • Stem cell-derived exosomes prevent pyroptosis and repair ischemic muscle injury through a novel exosome/circHIPK3/ FOXO3a pathway. Yan B, Zhang Y, Liang C, Liu B, Ding F, Wang Y, Zhu B, Zhao R, Yu XY, Li Y. Theranostics. 2020 May 18;10(15):6728-6742.

  • MicroRNA-421-3p-abundant small extracellular vesicles derived from M2 bone marrow-derived macrophages attenuate apoptosis and promote motor function recovery via inhibition of mTOR in spinal cord injury. Wang J, Rong Y, Ji C, Lv C, Jiang D, Ge X, Gong F, Tang P, Cai W, Liu W, Fan J. J Nanobiotechnology. 2020 May 13;18(1):72.

  • MicroRNA-421 improves ischemia/reperfusion injury via regulation toll-like receptor 4 pathway. Guo LL, Guo ML, Yao J, Weng YQ, Zhang XZ. J Int Med Res. 2020 Mar;48(3):300060519871863.

  • MicroRNA-421 inhibition alleviates bronchopulmonary dysplasia in a mouse model via targeting Fgf10. Yuan HS, Xiong DQ, Huang F, Cui J, Luo H. J Cell Biochem. 2019 Oct;120(10):16876-16887.

  • MicroRNA-421 induces hepatic mitochondrial dysfunction in non-alcoholic fatty liver disease mice by inhibiting sirtuin 3. Cheng Y, Mai J, Hou T, Ping J. Biochem Biophys Res Commun. 2016 May 20;474(1):57-63.

  • E2F1-dependent miR-421 regulates mitochondrial fragmentation and myocardial infarction by targeting Pink1. Wang K, Zhou LY, Wang JX, Wang Y, Sun T, Zhao B, Yang YJ, An T, Long B, Li N, Liu CY, Gong Y, Gao JN, Dong YH, Zhang J, Li PF. Nat Commun. 2015 Jul 17;6:7619.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • Ftx is dispensable for imprinted X-chromosome inactivation in preimplantation mouse embryos. Soma M, Fujihara Y, Okabe M, Ishino F, Kobayashi S. Sci Rep. 2014 Jun 5;4:5181.

  • Profiling circulating microRNA expression in experimental sepsis using cecal ligation and puncture. Wu SC, Yang JC, Rau CS, Chen YC, Lu TH, Lin MW, Tzeng SL, Wu YC, Wu CJ, Hsieh CH. PLoS One. 2013 Oct 30;8(10):e77936.

  • Identification of an imprinted gene cluster in the X-inactivation center. Kobayashi S, Totoki Y, Soma M, Matsumoto K, Fujihara Y, Toyoda A, Sakaki Y, Okabe M, Ishino F. PLoS One. 2013 Aug 6;8(8):e71222.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I, Beland FA. Lab Invest. 2010 Oct;90(10):1437-46.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.