Mature miRNA: mmu-miR-365-2-5p

Mature miRNA

miRNA Name mmu-miR-365-2-5p
Previous Name mmu-miR-365-2*
miRNA Sequence 5' - agggacuuucaggggcagcugug - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0017179
Similar miRNAs mmu-miR-365-1-5p (sharing the same seed sequence with mmu-miR-365-2-5p).

Precursor miRNA

Precursor Name mmu-mir-365-2
Genomic Location chr11:79726400-79726511 (+); nearby genomic features
NCBI GENE ID 723853
miRBase ID MI0001645
Precursor Sequence 
agagugaucaa g   --       a        ac   c       -----    u   u
           g aca  gcaagaa aaugaggg  uuu aggggca     gcug guu c
           | |||  ||||||| ||||||||  ||| |||||||     |||| ||| 
           c ugu  cguucuu uuauuccu  aaa uccccgu     ugac cag c
----gaggcua g   ga       g        aa   -       aauac    u   u

References

  • miR-365-3p mediates BCL11A and SOX6 erythroid-specific coregulation: A new player in HbF activation. Simbula M, Manchinu MF, Mingoia M, Pala M, Asunis I, Caria CA, Perseu L, Shah M, Crossley M, Moi P, Ristaldi MS. Mol Ther Nucleic Acids. 2023 Sep 9;34:102025.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I, Beland FA. Lab Invest. 2010 Oct;90(10):1437-46.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA, Olson EN. Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):13027-32.

  • MicroRNA profiling of developing and regenerating pancreas reveal post-transcriptional regulation of neurogenin3. Joglekar MV, Parekh VS, Mehta S, Bhonde RR, Hardikar AA. Dev Biol. 2007 Nov 15;311(2):603-12.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Maternal microRNAs are essential for mouse zygotic development. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Genes Dev. 2007 Mar 15;21(6):644-8.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Kloosterman WP, Wienholds E, de Bruijn E, Kauppinen S, Plasterk RH. Nat Methods. 2006 Jan;3(1):27-9.

  • Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M. Nature. 2005 Mar 17;434(7031):338-45.