Mature miRNA: mmu-miR-340-5p

Mature miRNA

miRNA Name mmu-miR-340-5p
miRNA Sequence 5' - uuauaaagcaaugagacugauu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004651

Precursor miRNA

Precursor Name mmu-mir-340
Genomic Location chr11:50069702-50069799 (+); nearby genomic features
NCBI GENE ID 723845
miRBase ID MI0000623
Precursor Sequence 
caauu     u      au       -caa      u    g     ug
     guacu ggugug  uauaaag    ugagac gauu ucaua  u
     ||||| ||||||  |||||||    |||||| |||| |||||   c
     uaugg ccauac  auauuuc    acucug cuag ggugu  g
-auuc     u      cg       auug      c    -     uu

References

  • The Involvement of the microRNAs miR-466c and miR-340 in the Palmitate-Mediated Dysregulation of Gonadotropin-Releasing Hormone Gene Expression. Nkechika V, Zhang N, Belsham DD. Genes (Basel). 2024 Mar 23;15(4):397.

  • CUL4A-mediated ZEB1/microRNA-340-5p/HMGB1 axis promotes the development of osteoporosis. Chen H, Zheng Q, Lv Y, Yang Z, Fu Q. J Biochem Mol Toxicol. 2023 Aug;37(8):e23373.

  • MiR-340-5p alleviates neuroinflammation and neuronal injury via suppressing STING in subarachnoid hemorrhage. Song N, Song R, Ma P. Brain Behav. 2022 Sep;12(9):e2687.

  • Suppression of microRNA 124-3p and microRNA 340-5p ameliorates retinoic acid-induced cleft palate in mice. Yoshioka H, Suzuki A, Iwaya C, Iwata J. Development. 2022 May 1;149(9):dev200476.

  • miR-340-5p Mediates Cardiomyocyte Oxidative Stress in Diabetes-Induced Cardiac Dysfunction by Targeting Mcl-1. Zhu Y, Yang X, Zhou J, Chen L, Zuo P, Chen L, Jiang L, Li T, Wang D, Xu Y, Li Q, Yan Y. Oxid Med Cell Longev. 2022 Jan 27;2022:3182931.

  • Serum Exosomal mir-340-5p Promotes Angiogenesis in Brain Microvascular Endothelial Cells During Oxygen-Glucose Deprivation. Xu C, Yu H, Chen B, Ma Y, Lv P. Neurochem Res. 2022 Apr;47(4):907-920.

  • Down-regulation of miR-340-5p promoted osteogenic differentiation through regulation of runt-related transcription factor-2 (RUNX2) in MC3T3-E1 cells. Wang X, Mi Y, He W, Hu X, Yang S, Zhao L, Zhang Y, Wen B. Bioengineered. 2021 Dec;12(1):1126-1137.

  • Protective Effect of miR-340-5p against Brain Injury after Intracerebral Hemorrhage by Targeting PDCD4. Zhou W, Huang G, Ye J, Jiang J, Xu Q. Cerebrovasc Dis. 2020;49(6):593-600.

  • LncRNA TUG1 competitively binds to miR-340 to accelerate myocardial ischemia-reperfusion injury. Wu X, Liu Y, Mo S, Wei W, Ye Z, Su Q. FASEB J. 2021 Jan;35(1):e21163.

  • MiR-340 suppresses CCl4-induced acute liver injury through exerting anti-inflammation targeting Sigirr. Liu HH, Li AJ. Eur Rev Med Pharmacol Sci. 2020 Oct;24(20):10687-10695.

  • Identification of CNS Injury-Related microRNAs as Novel Toll-Like Receptor 7/8 Signaling Activators by Small RNA Sequencing. Wallach T, Wetzel M, Dembny P, Staszewski O, Krüger C, Buonfiglioli A, Prinz M, Lehnardt S. Cells. 2020 Jan 11;9(1):186.

  • CD226 deficiency on regulatory T cells aggravates renal fibrosis via up-regulation of Th2 cytokines through miR-340. Mu Y, Zhang J, Liu Y, Ma J, Jiang D, Zhang X, Yi X, Cheng K, Shen S, Yang Y, Zhuang R, Zhang Y. J Leukoc Biol. 2020 Apr;107(4):573-587.

  • Downregulated microRNA-340-5p promotes proliferation and inhibits apoptosis of chondrocytes in osteoarthritis mice through inhibiting the extracellular signal-regulated kinase signaling pathway by negatively targeting the FMOD gene. Zhang W, Cheng P, Hu W, Yin W, Guo F, Chen A, Huang H. J Cell Physiol. 2018 Jan;234(1):927-939.

  • Alteration of microRNA 340-5p and Arginase-1 Expression in Peripheral Blood Cells during Acute Ischemic Stroke. Yoo H, Kim J, Lee AR, Lee JM, Kim OJ, Kim JK, Oh SH. Mol Neurobiol. 2019 May;56(5):3211-3221.

  • miR-340 Alleviates Psoriasis in Mice through Direct Targeting of IL-17A. Bian J, Liu R, Fan T, Liao L, Wang S, Geng W, Wang T, Shi W, Ruan Q. J Immunol. 2018 Sep 1;201(5):1412-1420.

  • Placental miR-340 mediates vulnerability to activity based anorexia in mice. Schroeder M, Jakovcevski M, Polacheck T, Drori Y, Luoni A, Röh S, Zaugg J, Ben-Dor S, Albrecht C, Chen A. Nat Commun. 2018 Apr 23;9(1):1596.

  • Elevated expression of miR-146, miR-139 and miR-340 involved in regulating Th1/Th2 balance with acute exposure of fine particulate matter in mice. Hou T, Liao J, Zhang C, Sun C, Li X, Wang G. Int Immunopharmacol. 2018 Jan;54:68-77.

  • miRNA-340 inhibits osteoclast differentiation via repression of MITF. Zhao H, Zhang J, Shao H, Liu J, Jin M, Chen J, Huang Y. Biosci Rep. 2017 Jul 20;37(4):BSR20170302.

  • MicroRNA-146a provides feedback regulation of lyme arthritis but not carditis during infection with Borrelia burgdorferi. Lochhead RB, Ma Y, Zachary JF, Baltimore D, Zhao JL, Weis JH, O'Connell RM, Weis JJ. PLoS Pathog. 2014 Jun 26;10(6):e1004212.

  • A MicroRNA Profile in Fmr1 Knockout Mice Reveals MicroRNA Expression Alterations with Possible Roles in Fragile X Syndrome. Liu T, Wan RP, Tang LJ, Liu SJ, Li HJ, Zhao QH, Liao WP, Sun XF, Yi YH, Long YS. Mol Neurobiol. 2015;51(3):1053-63.

    • There are 31 references associated with mmu-miR-340-5p. Click here to see the complete list in PubMed.