Mature miRNA: mmu-miR-324-3p

Mature miRNA

miRNA Name mmu-miR-324-3p
miRNA Sequence 5' - ccacugccccaggugcugcu - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000556

Precursor miRNA

Precursor Name mmu-mir-324
Genomic Location chr11:70012043-70012131 (+); nearby genomic features
NCBI GENE ID 723896
miRBase ID MI0000595
Precursor Sequence 
aacu      gc     c   u c   a     u   u  aaag
    gacuau  cuccu gca c ccu gggca ugg gu    c
    ||||||  ||||| ||| | ||| ||||| ||| ||    
    cugaug  ggggg cgu g gga cccgu acc ca    u
cagu      uu     u   c u   c     c   -  gagg

References

  • Mir324 knockout regulates the structure of dendritic spines and impairs hippocampal long-term potentiation. Parkins EV, Brager DH, Rymer JK, Burwinkel JM, Rojas D, Tiwari D, Hu YC, Gross C. Sci Rep. 2023 Dec 8;13(1):21919.

  • LncRNA SNHG11 induces ferroptosis in liver injury cells through miR-324-3p/GPX4 axis-mediated sepsis. Yang Y, Wang A, Zhou J, Yang Y, Wu H. Cell Mol Biol (Noisy-le-grand). 2023 Nov 30;69(12):163-169.

  • Age-Dependent Regulation of Dendritic Spine Density and Protein Expression in Mir324 KO Mice. Parkins EV, Burwinkel JM, Ranatunga R, Yaser S, Hu YC, Tiwari D, Gross C. J Mol Neurosci. 2023 Oct;73(9-10):818-830.

  • Long Noncoding RNA AROD Inhibits Host Antiviral Innate Immunity via the miR-324-5p-CUEDC2 Axis. Zhang Z, Yu T, Li H, Du L, Jin Z, Peng X, Yan Y, Zhou J, Gu J. Microbiol Spectr. 2023 Jun 15;11(3):e0420622.

  • miR-324-5p and miR-30c-2-3p Alter Renal Mineralocorticoid Receptor Signaling under Hypertonicity. Vu TA, Lema I, Hani I, Cheval L, Atger-Lallier L, Souvannarath V, Perrot J, Souvanheuane M, Marie Y, Fabrega S, Blanchard A, Bouligand J, Kamenická»· P, Crambert G, Martinerie L, Lombès M, Viengchareun S. Cells. 2022 Apr 19;11(9):1377.

  • MicroRNA-324-3p Plays A Protective Role Against Coxsackievirus B3-Induced Viral Myocarditis. Liu T, Tong J, Shao C, Qu J, Wang H, Shi Y, Lin Y, Liu Y, Shao S, Shen H. Virol Sin. 2021 Dec;36(6):1585-1599.

  • Increased hippocampal excitability in miR-324-null mice. Hayman DJ, Modebadze T, Charlton S, Cheung K, Soul J, Lin H, Hao Y, Miles CG, Tsompani D, Jackson RM, Briggs MD, Piróg KA, Clark IM, Barter MJ, Clowry GJ, LeBeau FEN, Young DA. Sci Rep. 2021 May 17;11(1):10452.

  • miRNA-324/-133a essential for recruiting new synapse innervations and associative memory cells in coactivated sensory cortices. Wu R, Cui S, Wang JH. Neurobiol Learn Mem. 2020 Jul;172:107246.

  • miR-324-5p promotes adipocyte differentiation and lipid droplet accumulation by targeting Krueppel-like factor 3 (KLF3). Zhou X, Shi X, Wang J, Zhang X, Xu Y, Liu Y, Li X, Yang G. J Cell Physiol. 2020 Oct;235(10):7484-7495.

  • Differentially expressed microRNA profiles in exosomes from vascular smooth muscle cells associated with coronary artery calcification. Pan W, Liang J, Tang H, Fang X, Wang F, Ding Y, Huang H, Zhang H. Int J Biochem Cell Biol. 2020 Jan;118:105645.

  • Inhibition of miR-324-5p increases PM20D1-mediated white and brown adipose loss and reduces body weight in juvenile mice. Li D, Liu Y, Gao W, Han J, Yuan R, Zhang M, Pang W. Eur J Pharmacol. 2019 Nov 15;863:172708.

  • MicroRNA inhibition upregulates hippocampal A-type potassium current and reduces seizure frequency in a mouse model of epilepsy. Tiwari D, Brager DH, Rymer JK, Bunk AT, White AR, Elsayed NA, Krzeski JC, Snider A, Schroeder Carter LM, Danzer SC, Gross C. Neurobiol Dis. 2019 Oct;130:104508.

  • Astrocytic miR-324-5p is essential for synaptic formation by suppressing the secretion of CCL5 from astrocytes. Sun C, Zhu L, Ma R, Ren J, Wang J, Gao S, Yang D, Ning K, Ling B, Lu B, Chen X, Xu J. Cell Death Dis. 2019 Feb 13;10(2):141.

  • miR-324-5p is up regulated in end-stage osteoarthritis and regulates Indian Hedgehog signalling by differing mechanisms in human and mouse. Woods S, Barter MJ, Elliott HR, McGillivray CM, Birch MA, Clark IM, Young DA. Matrix Biol. 2019 Apr;77:87-100.

  • MicroRNA-Mediated Downregulation of the Potassium Channel Kv4.2 Contributes to Seizure Onset. Gross C, Yao X, Engel T, Tiwari D, Xing L, Rowley S, Danielson SW, Thomas KT, Jimenez-Mateos EM, Schroeder LM, Pun RYK, Danzer SC, Henshall DC, Bassell GJ. Cell Rep. 2016 Sep 27;17(1):37-45.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • A MicroRNA Profile in Fmr1 Knockout Mice Reveals MicroRNA Expression Alterations with Possible Roles in Fragile X Syndrome. Liu T, Wan RP, Tang LJ, Liu SJ, Li HJ, Zhao QH, Liao WP, Sun XF, Yi YH, Long YS. Mol Neurobiol. 2015;51(3):1053-63.

  • Dysregulation of the miR-324-5p-CUEDC2 axis leads to macrophage dysfunction and is associated with colon cancer. Chen Y, Wang SX, Mu R, Luo X, Liu ZS, Liang B, Zhuo HL, Hao XP, Wang Q, Fang DF, Bai ZF, Wang QY, Wang HM, Jin BF, Gong WL, Zhou T, Zhang XM, Xia Q, Li T. Cell Rep. 2014 Jun 26;7(6):1982-93.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2. Polikepahad S, Corry DB. Nucleic Acids Res. 2013 Jan;41(2):1164-77.

    • There are 34 references associated with mmu-miR-324-3p. Click here to see the complete list in PubMed.