Mature miRNA: mmu-miR-30a-3p

Mature miRNA

miRNA Name mmu-miR-30a-3p
Previous Name mmu-miR-30a-3p;mmu-miR-30a*
miRNA Sequence 5' - cuuucagucggauguuugcagc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000129
Similar miRNAs mmu-miR-30d-3p, mmu-miR-30e-3p (sharing the same seed sequence with mmu-miR-30a-3p).

Precursor miRNA

Precursor Name mmu-mir-30a
Genomic Location chr1:23272269-23272339 (+); nearby genomic features
NCBI GENE ID 387225
miRBase ID MI0000144
Precursor Sequence 
   a            uc           -----   a
gcg cuguaaacaucc  gacuggaagcu     gug a
||| ||||||||||||  |||||||||||     ||| 
cgu gacguuuguagg  cugacuuucgg     cac g
   c            --           guaaa   c

References

  • DEmiRNA-mRNA regulatory network reveals miR-122-5p as a regulatory factor of arginine metabolism in necrotizing enterocolitis. Ding Z, Guo T, Tang Q, Hong Y, Lv Z, Lu L, Zhuang W. Front Genet. 2025 Jan 22;15:1480431.

  • Interindividual Variation in Gut Nitrergic Neuron Density Is Regulated By GDNF Levels and ETV1. Virtanen HT, Choopanian P, Porokuokka LL, Forsgård R, Garton DR, Olfat S, Korpela R, Mirzaie M, Andressoo JO. Cell Mol Gastroenterol Hepatol. 2024;18(6):101405.

  • miR-30a-5p targets ITGA6 to inhibit oral squamous cell carcinoma progression. Zhang G, Wang H, Liu G, Huang J. Pathol Res Pract. 2024 Jan;253:155021.

  • Exosome miR-30a-5p Regulates Glomerular Endothelial Cells' EndMT and Angiogenesis by Modulating Notch1/VEGF Signaling Pathway. Ning Y, Zhou X, Wang G, Zhang L, Wang J. Curr Gene Ther. 2024;24(2):159-177.

  • miR-30a-3p Regulates Autophagy in the Involution of Mice Mammary Glands. Tian L, Guo S, Zhao Z, Chen Y, Wang C, Li Q, Li Y. Int J Mol Sci. 2023 Sep 20;24(18):14352.

  • Loss of microRNA-30a and sex-specific effects on the neonatal hyperoxic lung injury. Grimm SL, Reddick S, Dong X, Leek C, Wang AX, Gutierrez MC, Hartig SM, Moorthy B, Coarfa C, Lingappan K. Biol Sex Differ. 2023 Aug 8;14(1):50.

  • Tumor-suppressive action of miR-30a-5p in lung adenocarcinoma correlates with ABL2 inhibition and PI3K/AKT pathway inactivation. Miao Y, Liu J. Clin Transl Oncol. 2024 Feb;26(2):398-413.

  • MicroRNA‑30a‑5p regulates cypermethrin-induced apoptosis of Sertoli cells by targeting KLF9 in vitro. Wang Q, Xie JF, Yao TT, Wang XX, Guo QW, Wang LS, Yu Y, Xu LC. Reprod Toxicol. 2023 Aug;119:108414.

  • Cardioprotective effects of circ_0002612 in myocardial ischemia/reperfusion injury correlate with disruption of miR-30a-5p-dependent Ppargc1a inhibition. Liu X, Dou B, Tang W, Yang H, Chen K, Wang Y, Qin J, Yang F. Int Immunopharmacol. 2023 Apr;117:110006.

  • The rheumatoid arthritis drug auranofin lowers leptin levels and exerts antidiabetic effects in obese mice. Cox AR, Masschelin PM, Saha PK, Felix JB, Sharp R, Lian Z, Xia Y, Chernis N, Bader DA, Kim KH, Li X, Yoshino J, Li X, Li G, Sun Z, Wu H, Coarfa C, Moore DD, Klein S, Sun K, Hartig SM. Cell Metab. 2022 Dec 6;34(12):1932-1946.e7.

  • Suppression of bone remodeling associated with long-term bisphosphonate treatment is mediated by microRNA-30a-5p. Li X, Xu R, Ye JX, Yuan FL. Bioengineered. 2022 Apr;13(4):9741-9753.

  • miR-30a-5p induces Aβ production via inhibiting the nonamyloidogenic pathway in Alzheimer's disease. Sun T, Zhao K, Liu M, Cai Z, Zeng L, Zhang J, Li Z, Liu R. Pharmacol Res. 2022 Apr;178:106153.

  • Epithelial microRNA-30a-3p targets RUNX2/HMGB1 axis to suppress airway eosinophilic inflammation in asthma. Wu W, Gao J, Chen D, Chen G, Feng Y, Chang C, Chen S, Yi L, Zhen G. Respir Res. 2022 Jan 29;23(1):17.

  • LncRNA HOX transcript antisense RNA mitigates cardiac function injury in chronic heart failure via regulating microRNA-30a-5p to target KDM3A. Zhang X, Gao Y, Wu H, Mao Y, Qi Y. J Cell Mol Med. 2022 Mar;26(5):1473-1485.

  • [Activation of mir-30a-wnt/β-catenin signaling pathway upregulates cathepsin K expression to promote cementogenic differentiation of periodontal ligament stem cells]. Liu F, Zhou Z, Xue Y, Zhu B, Wu B, Chen F. Nan Fang Yi Ke Da Xue Xue Bao. 2021 Oct 20;41(10):1439-1447.

  • miR-30a-5p inhibits osteogenesis and promotes periodontitis by targeting Runx2. Liu X, Yang B, Zhang Y, Guo X, Yang Q, Liu X, Bai Q, Lu Q. BMC Oral Health. 2021 Oct 11;21(1):513.

  • miR-30a-5p suppresses lung squamous cell carcinoma via ATG5 - mediated autophagy. Yang J, Rao S, Cao R, Xiao S, Cui X, Ye L. Aging (Albany NY). 2021 Jul 12;13(13):17462-17472.

  • CircHIPK3 regulates pulmonary fibrosis by facilitating glycolysis in miR-30a-3p/FOXK2-dependent manner. Xu Q, Cheng D, Li G, Liu Y, Li P, Sun W, Ma D, Ni C. Int J Biol Sci. 2021 Jun 4;17(9):2294-2307.

  • MicroRNA-30a-5p promotes differentiation in neonatal mouse spermatogonial stem cells (SSCs). Khanehzad M, Nourashrafeddin SM, Abolhassani F, Kazemzadeh S, Madadi S, Shiri E, Khanlari P, Khosravizadeh Z, Hedayatpour A. Reprod Biol Endocrinol. 2021 Jun 9;19(1):85.

  • miR‑30a‑5p mitigates autophagy by regulating the Beclin‑1/ATG16 pathway in renal ischemia/reperfusion injury. Fang Y, Zou L, He W. Int J Mol Med. 2021 Jul;48(1):144.

    • There are 80 references associated with mmu-miR-30a-3p. Click here to see the complete list in PubMed.