Mature miRNA: mmu-miR-21a-5p

Mature miRNA

miRNA Name mmu-miR-21a-5p
Previous Name mmu-miR-21;mmu-miR-21-5p
miRNA Sequence 5' - uagcuuaucagacugauguuga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000530
Similar miRNAs mmu-miR-21c, mmu-miR-590-5p (sharing the same seed sequence with mmu-miR-21a-5p).

Precursor miRNA

Precursor Name mmu-mir-21a
Genomic Location chr11:86584067-86584158 (-); nearby genomic features
NCBI GENE ID 387140
miRBase ID MI0000569
Precursor Sequence 
u      ccu                a     a     a    u a
 guacca   ugucggauagcuuauc gacug uguug cugu g a
 ||||||   |||||||||||||||| ||||| ||||| |||| |  u
 uauggu   acagucugucggguag cugac acaac ggua c c
c      uuu                -     g     -    - u

References

  • MiR-21 suppression in macrophages promotes M2-like polarization and attenuates kidney ischemia-reperfusion injury. Wang X, Ren T, Zhang X, Pan T, Peng F, Feng J, Sun Q, Song N, Ding X, Jia P. FASEB J. 2024 Dec 15;38(23):e70251.

  • MicroRNA-21 modulates brown adipose tissue adipogenesis and thermogenesis in a mouse model of polycystic ovary syndrome. Rezq S, Huffman AM, Basnet J, Alsemeh AE, do Carmo JM, Yanes Cardozo LL, Romero DG. Biol Sex Differ. 2024 Jul 10;15(1):53.

  • A miRNA-21-Mediated PTEN/Akt/NF-κB Axis Promotes Chronic Obstructive Pulmonary Disease Pathogenesis. Sai X, Qin C, Zhang Z, Yu H, Bian T. Int J Chron Obstruct Pulmon Dis. 2024 May 25;19:1141-1151.

  • BMSC-derived exosomes regulate the Treg/Th17 balance through the miR-21-5p/TLR4/MyD88/NF-κB pathway to alleviate dry eye symptoms in mice. Zhao D, Ji H, Zhao H, Xu Y, He A, He Y. In Vitro Cell Dev Biol Anim. 2024 Jun;60(6):644-656.

  • miR-21-5p-loaded bone mesenchymal stem cell-derived exosomes repair ovarian function in autoimmune premature ovarian insufficiency by targeting MSX1. Yang Y, Tang L, Xiao Y, Huang W, Gao M, Xie J, Yang M, Wu Y, Fu X. Reprod Biomed Online. 2024 Jun;48(6):103815.

  • The mechanisms of MicroRNA 21 in premature ovarian insufficiency mice with mesenchymal stem cells transplantation : The involved molecular and immunological mechanisms. Yin N, Luo C, Wei L, Yang G, Bo L, Mao C. J Ovarian Res. 2024 Apr 4;17(1):75.

  • MicroRNA-21a-5p inhibition alleviates systemic sclerosis by targeting STAT3 signaling. Park JS, Kim C, Choi J, Jeong HY, Moon YM, Kang H, Lee EK, Cho ML, Park SH. J Transl Med. 2024 Apr 1;22(1):323.

  • miRNA‑21 promotes the progression of acute liver failure via the KLF6/autophagy/IL‑23 signaling pathway. Bao S, Zheng W, Yan R, Xu J. Mol Med Rep. 2024 May;29(5):80.

  • RGS6 drives cardiomyocyte death following nucleolar stress by suppressing Nucleolin/miRNA-21. Sengar AS, Kumar M, Rai C, Chakraborti S, Kumar D, Kumar P, Mukherjee S, Mondal K, Stewart A, Maity B. J Transl Med. 2024 Feb 26;22(1):204.

  • Hepatocyte miR-21-5p-deficiency alleviates APAP-induced liver injury by inducing PPARγ and autophagy. Xu C, Yan F, Zhao Y, Jaeschke H, Wu J, Fang L, Zhao L, Zhao Y, Wang L. Toxicol Sci. 2024 Feb 28;198(1):50-60.

  • Differential effects of microRNAs miR-21, miR-99 and miR-145 on lung regeneration and inflammation during recovery from influenza pneumonia. Ong JWJ, Tan KS, Lee JJX, Seet JE, Choi HW, Ler SG, Gunaratne J, Narasaraju T, Sham LT, Patzel V, Chow VT. J Med Virol. 2023 Dec;95(12):e29286.

  • miR-21 Expressed by Dermal Fibroblasts Enhances Skin Wound Healing Through the Regulation of Inflammatory Cytokine Expression. Liu C, Zhang Q, Liu Z, Zhuang D, Wang S, Deng H, Shi Y, Sun J, Guo J, Wei F, Wu X. Inflammation. 2024 Apr;47(2):572-590.

  • The lncRNA MEG3/miRNA-21/P38MAPK axis inhibits coxsackievirus 3 replication in acute viral myocarditis. He F, Liu Z, Feng M, Xiao Z, Yi X, Wu J, Liu Z, Wang G, Li L, Yao H. Virus Res. 2024 Jan 2;339:199250.

  • TLR7 activation by miR-21 promotes renal fibrosis by activating the pro-inflammatory signaling pathway in tubule epithelial cells. Kim J, Ha S, Son M, Kim D, Kim MJ, Kim B, Kim D, Chung HY, Chung KW. Cell Commun Signal. 2023 Aug 18;21(1):215.

  • miR-21-5p promotes NASH-related hepatocarcinogenesis. Rodrigues PM, Afonso MB, Simão AL, Islam T, Gaspar MM, O'Rourke CJ, Lewinska M, Andersen JB, Arretxe E, Alonso C, Santos-Laso Á, Izquierdo-Sanchez L, Jimenez-Agüero R, Eizaguirre E, Bujanda L, Pareja MJ, Prip-Buus C, Banales JM, Rodrigues CMP, Castro RE. Liver Int. 2023 Oct;43(10):2256-2274.

  • Mesenchymal stem cells, as glioma exosomal immunosuppressive signal multipliers, enhance MDSCs immunosuppressive activity through the miR-21/SP1/DNMT1 positive feedback loop. Qiu W, Guo Q, Guo X, Wang C, Li B, Qi Y, Wang S, Zhao R, Han X, Du H, Zhao S, Pan Z, Fan Y, Wang Q, Gao Z, Li G, Xue H. J Nanobiotechnology. 2023 Jul 22;21(1):233.

  • Exosomal miR-21 determines lung-to-brain metastasis specificity through the DGKB/ERK axis within the tumor microenvironment. Tiong TY, Chan ML, Wang CH, Yadav VK, Pikatan NW, Fong IH, Yeh CT, Kuo KT, Huang WC. Life Sci. 2023 Sep 15;329:121945.

  • Radiofrequency Ablation-Induced Tumor Growth Is Suppressed by MicroRNA-21 Inhibition in Murine Models of Intrahepatic Colorectal Carcinoma. Salvermoser L, Goldberg SN, Laville F, Markezana A, Stechele M, Ahmed M, Wildgruber M, Kazmierczak PM, Alunni-Fabbroni M, Galun E, Ricke J, Paldor M. J Vasc Interv Radiol. 2023 Oct;34(10):1785-1793.e2.

  • Loss of microRNA-21 protects against acetaminophen-induced hepatotoxicity in mice. Huffman AM, Syed M, Rezq S, Anderson CD, Yanes Cardozo LL, Romero DG. Arch Toxicol. 2023 Jul;97(7):1907-1925.

  • MiR-21-5p regulates the dynamic of mitochondria network and rejuvenates the senile phenotype of bone marrow stromal cells (BMSCs) isolated from osteoporotic SAM/P6 mice. Sikora M, Åšmieszek A, Pielok A, Marycz K. Stem Cell Res Ther. 2023 Mar 29;14(1):54.

    • There are 383 references associated with mmu-miR-21a-5p. Click here to see the complete list in PubMed.