Mature miRNA: mmu-miR-214-5p

Mature miRNA

miRNA Name mmu-miR-214-5p
Previous Name mmu-miR-214*
miRNA Sequence 5' - ugccugucuacacuugcugugc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004664

Precursor miRNA

Precursor Name mmu-mir-214
Genomic Location chr1:162223368-162223477 (+); nearby genomic features
Clustered miRNAs mmu-mir-199a-2,mmu-mir-214 (within 10kb in genome)
NCBI GENE ID 387210
miRBase ID MI0000698
Precursor Sequence 
ggccu      acaga           u          aca            aacau
     ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
     ||||||     ||||||||||| ||||||||||   ||||||||||||      c
     ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
----u      -----           u          cac            cacuc

References

  • Alleviation of preeclampsia-like symptoms through PlGF and eNOS regulation by hypoxia- and NF-κB-responsive miR-214-3p deletion. Kim S, Shim S, Kwon J, Ryoo S, Byeon J, Hong J, Lee JH, Kwon YG, Kim JY, Kim YM. Exp Mol Med. 2024 Jun;56(6):1388-1400.

  • MiR-214-3p overexpression-triggered chondroitin polymerizing factor (CHPF) inhibition modulates the ferroptosis and metabolism in colon cancer. Yun ZY, Wu D, Wang X, Huang P, Li N. Kaohsiung J Med Sci. 2024 Mar;40(3):244-254.

  • DNM3OS Enhances the Apoptosis and Senescence of Spermatogonia Associated with Nonobstructive Azoospermia by Providing miR-214-5p and Decreasing E2F2 Expression. Hua R, Chu Q, Guo F, Chen Q, Li M, Zhou X, Zhu Y. Anal Cell Pathol (Amst). 2023 Dec 20;2023:1477658.

  • Vascular smooth muscle cell-specific miRNA-214 deficiency alleviates simulated microgravity-induced vascular remodeling. Li Y, Zhao Y, Zhong G, Xu Q, Tan Y, Xing W, Cao D, Wang Y, Liu C, Li J, Du R, Sun W, Yuan X, Li Y, Liu Z, Jin X, Zhao D, Song J, Wang Y, Kan G, Han X, Liu S, Yuan M, Gao F, Shu J, Li Y, Ling S. FASEB J. 2024 Jan;38(1):e23369.

  • CircRNA itchy E3 ubiquitin protein ligase improves mitochondrial dysfunction in sepsis-induced acute kidney injury by targeting microRNA-214-3p/ATP-binding cassette A1 axis. Ye W, Miao Q, Xu G, Jin K, Li X, Wu W, Yu L, Yan M. Ren Fail. 2023;45(2):2261552.

  • miR-214 could promote myocardial fibrosis and cardiac mesenchymal transition in VMC mice through regulation of the p53 or PTEN-PI3K-Akt signali pathway, promoting CF proliferation and inhibiting its ng pathway. Huang X, Zheng D, Liu C, Huang J, Chen X, Zhong J, Wang J, Lin X, Zhao C, Chen M, Su S, Chen Y, Xu C, Lin C, Huang Y, Zhang S. Int Immunopharmacol. 2023 Nov;124(Pt A):110765.

  • Inhibition of miR-214-3p attenuates ferroptosis in myocardial infarction via regulating ME2. Liu F, Jiang LJ, Zhang YX, Xu ST, Liu SL, Ye JT, Liu PQ. Biochem Biophys Res Commun. 2023 Jun 18;661:64-74.

  • Stroma-derived miR-214 coordinates tumor dissemination. Orso F, Virga F, Dettori D, Dalmasso A, Paradzik M, Savino A, Pomatto MAC, Quirico L, Cucinelli S, Coco M, Mareschi K, Fagioli F, Salmena L, Camussi G, Provero P, Poli V, Mazzone M, Pandolfi PP, Taverna D. J Exp Clin Cancer Res. 2023 Jan 13;42(1):20.

  • Knockdown of miR-214 Alleviates Renal Interstitial Fibrosis by Targeting the Regulation of the PTEN/PI3K/AKT Signalling Pathway. Hou D, Wu Q, Wang S, Pang S, Liang H, Lyu H, Zhou L, Wang Q, Hao L. Oxid Med Cell Longev. 2022 Oct 15;2022:7553928.

  • Up-regulating microRNA-214-3p relieves hypoxic-ischemic brain damage through inhibiting TXNIP expression. Zhang M, Zhou H, He R, Yang J, Zou Y, Deng Y, Xie H, Yan Z. Mol Cell Biochem. 2023 Mar;478(3):597-608.

  • ATF1/miR-214-5p/ITGA7 axis promotes osteoclastogenesis to alter OVX-induced bone absorption. Liu LL, Xiao YS, Huang WM, Liu S, Huang LX, Zhong JH, Jia P, Liu WY. Mol Med. 2022 May 14;28(1):56.

  • MicroRNA-214-3p aggravates ferroptosis by targeting GPX4 in cisplatin-induced acute kidney injury. Zhou J, Xiao C, Zheng S, Wang Q, Zhu H, Zhang Y, Wang R. Cell Stress Chaperones. 2022 Jul;27(4):325-336.

  • Vascular smooth muscle cell-specific miRNA-214 knockout inhibits angiotensin II-induced hypertension through upregulation of Smad7. Li Y, Li H, Xing W, Li J, Du R, Cao D, Wang Y, Yang X, Zhong G, Zhao Y, Sun W, Liu C, Gao X, Li Y, Liu Z, Jin X, Zhao D, Tan Y, Wang Y, Liu S, Yuan M, Song J, Chang YZ, Gao F, Ling S, Li Y. FASEB J. 2021 Nov;35(11):e21947.

  • Downregulation of miR‑214-3p attenuates mesangial hypercellularity by targeting PTEN‑mediated JNK/c-Jun signaling in IgA nephropathy. Li Y, Xia M, Peng L, Liu H, Chen G, Wang C, Yuan D, Liu Y, Liu H. Int J Biol Sci. 2021 Jul 31;17(13):3343-3355.

  • Involvement of miR-214-3p/FOXM1 Axis During the Progression of Psoriasis. Zhao J, Wang F, Tian Q, Dong J, Chen L, Hu R. Inflammation. 2022 Feb;45(1):267-278.

  • LncRNA XIST shuttled by adipose tissue-derived mesenchymal stem cell-derived extracellular vesicles suppresses myocardial pyroptosis in atrial fibrillation by disrupting miR-214-3p-mediated Arl2 inhibition. Yan B, Liu T, Yao C, Liu X, Du Q, Pan L. Lab Invest. 2021 Nov;101(11):1427-1438.

  • MicroRNA-214-5p aggravates sepsis-related acute kidney injury in mice. Guo C, Ye FX, Jian YH, Liu CH, Tu ZH, Yang DP. Drug Dev Res. 2022 Apr;83(2):339-350.

  • miR‑214 ameliorates sepsis‑induced acute kidney injury via PTEN/AKT/mTOR‑regulated autophagy. Sang Z, Dong S, Zhang P, Wei Y. Mol Med Rep. 2021 Oct;24(4):683.

  • Cartilage tissue miR-214-3p regulates the TrkB/ShcB pathway paracrine VEGF to promote endothelial cell migration and angiogenesis. Xiao P, Zhu X, Sun J, Zhang Y, Qiu W, Li J, Wu X. Bone. 2021 Oct;151:116034.

  • microRNA-214-3p Suppresses Ankylosing Spondylitis Fibroblast Osteogenesis Ding L, Yin Y, Hou Y, Jiang H, Zhang J, Dai Z, Zhang G. Front Endocrinol (Lausanne). 2021 Apr 15;11:609753.

    • There are 124 references associated with mmu-miR-214-5p. Click here to see the complete list in PubMed.