Mature miRNA: mmu-miR-1948-3p

Mature miRNA

miRNA Name mmu-miR-1948-3p
Previous Name mmu-miR-1948
miRNA Sequence 5' - uuuaggcagagcacucguacag - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0009415

Precursor miRNA

Precursor Name mmu-mir-1948
Genomic Location chr18:12714811-12714895 (+); nearby genomic features
NCBI GENE ID 100316699
miRBase ID MI0009939
Precursor Sequence 
              a       a               gug
auucucaccuuacu uaugagu uucugccuaaaugug   u
|||||||||||||| ||||||| |||||||||||||||    a
uaagaguggaauga augcuca gagacggauuuacau   c
              c       c               agg

References

  • Functional Roles of Sex-Biased, Growth Hormone-Regulated MicroRNAs miR-1948 and miR-802 in Young Adult Mouse Liver. Hao P, Waxman DJ. Endocrinology. 2018 Mar 1;159(3):1377-1392.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. Zhu JY, Strehle M, Frohn A, Kremmer E, Höfig KP, Meister G, Adler H. J Virol. 2010 Oct;84(19):10266-75.

  • Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I, Beland FA. Lab Invest. 2010 Oct;90(10):1437-46.

  • In-depth characterization of the microRNA transcriptome in a leukemia progression model. Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK. Genome Res. 2008 Nov;18(11):1787-97.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.