Mature miRNA: mmu-miR-191-5p

Mature miRNA

miRNA Name mmu-miR-191-5p
Previous Name mmu-miR-191
miRNA Sequence 5' - caacggaaucccaaaagcagcug - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000221

Precursor miRNA

Precursor Name mmu-mir-191
Genomic Location chr9:108568319-108568392 (+); nearby genomic features
Clustered miRNAs mmu-mir-191,mmu-mir-425 (within 10kb in genome)
NCBI GENE ID 387186
miRBase ID MI0000233
Precursor Sequence 
      c          c  aa       uu  -  c
agcggg aacggaaucc aa  gcagcug  gu cu c
|||||| |||||||||| ||  |||||||  || || 
ucgucc uugcuuuagg uu  cgucgac  ua ga a
      c          -  ca       cu  c  g

References

  • Long Non-Coding RNA ANRIL Regulates Inflammatory Factor Expression in Ulcerative Colitis Via the miR-191-5p/SATB1 Axis. Yu KQ, Li CF, Ye L, Song Y, Wang YH, Lin YR, Liao ST, Mei ZC, Lv L. Inflammation. 2024 Apr;47(2):513-529.

  • MiR-191-5p Disturbed the Angiogenesis in a Mice Model of Cerebral Infarction by Targeting Inhibition of BDNF. Wu Y, Yang S, Zheng Z, Pan H, Jiang Y, Bai X, Liu T, Deng S, Li Y. Neurol India. 2021 Nov-Dec;69(6):1601-1607.

  • MiR-191-5p alleviates microglial cell injury by targeting Map3k12 (mitogen-activated protein kinase kinase kinase 12) to inhibit the MAPK (mitogen-activated protein kinase) signaling pathway in Alzheimer's disease. Wan W, Liu G, Li X, Liu Y, Wang Y, Pan H, Hu J. Bioengineered. 2021 Dec;12(2):12678-12690.

  • miR-191 modulates B-cell development and targets transcription factors E2A, Foxp1, and Egr1. Blume J, ZiÄ™tara N, Witzlau K, Liu Y, Sanchez OO, PuchaÅ‚ka J, Winter SJ, Kunze-Schumacher H, Saran N, Düber S, Roy B, Weiss S, Klein C, Wurst W, Łyszkiewicz M, Krueger A. Eur J Immunol. 2019 Jan;49(1):121-132.

  • Hypoxia-induced microRNA-191 contributes to hepatic ischemia/reperfusion injury through the ZONAB/Cyclin D1 axis. Pan W, Wang L, Zhang XF, Zhang H, Zhang J, Wang G, Xu P, Zhang Y, Hu P, Zhang XD, Du RL, Wang H. Cell Death Differ. 2019 Jan;26(2):291-305.

  • MicroRNA-101 Regulates Multiple Developmental Programs to Constrain Excitation in Adult Neural Networks. Lippi G, Fernandes CC, Ewell LA, John D, Romoli B, Curia G, Taylor SR, Frady EP, Jensen AB, Liu JC, Chaabane MM, Belal C, Nathanson JL, Zoli M, Leutgeb JK, Biagini G, Yeo GW, Berg DK. Neuron. 2016 Dec 21;92(6):1337-1351.

  • The MicroRNA miR-191 Supports T Cell Survival Following Common γ Chain Signaling. Lykken EA, Li QJ. J Biol Chem. 2016 Nov 4;291(45):23532-23544.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • MicroRNA-188 regulates age-related switch between osteoblast and adipocyte differentiation. Li CJ, Cheng P, Liang MK, Chen YS, Lu Q, Wang JY, Xia ZY, Zhou HD, Cao X, Xie H, Liao EY, Luo XH. J Clin Invest. 2015 Apr;125(4):1509-22.

  • PU.1 promotes miR-191 to inhibit adipogenesis in 3T3-L1 preadipocytes. Ji S, Li W, Bao L, Han P, Yang W, Ma L, Meng F, Cao B. Biochem Biophys Res Commun. 2014 Aug 22;451(2):329-33.

  • miR-1, miR-10b, miR-155, and miR-191 are novel regulators of BDNF. Varendi K, Kumar A, Härma MA, Andressoo JO. Cell Mol Life Sci. 2014 Nov;71(22):4443-56.

  • miR-191 and miR-135 are required for long-lasting spine remodelling associated with synaptic long-term depression. Hu Z, Yu D, Gu QH, Yang Y, Tu K, Zhu J, Li Z. Nat Commun. 2014;5:3263.

  • A novel cardiomyocyte-enriched microRNA, miR-378, targets insulin-like growth factor 1 receptor: implications in postnatal cardiac remodeling and cell survival. Knezevic I, Patel A, Sundaresan NR, Gupta MP, Solaro RJ, Nagalingam RS, Gupta M. J Biol Chem. 2012 Apr 13;287(16):12913-26.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miR-191 regulates mouse erythroblast enucleation by down-regulating Riok3 and Mxi1. Zhang L, Flygare J, Wong P, Lim B, Lodish HF. Genes Dev. 2011 Jan 15;25(2):119-24.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I, Beland FA. Lab Invest. 2010 Oct;90(10):1437-46.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

    • There are 31 references associated with mmu-miR-191-5p. Click here to see the complete list in PubMed.