Mature miRNA: mmu-miR-181c-3p

Mature miRNA

miRNA Name mmu-miR-181c-3p
Previous Name mmu-miR-181c*
miRNA Sequence 5' - accaucgaccguugaguggacc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0017068
Similar miRNAs mmu-miR-181a-1-3p (sharing the same seed sequence with mmu-miR-181c-3p).

Precursor miRNA

Precursor Name mmu-mir-181c
Genomic Location chr8:84178873-84178961 (-); nearby genomic features
Clustered miRNAs mmu-mir-181d,mmu-mir-181c (within 10kb in genome)
NCBI GENE ID 723819
miRBase ID MI0000724
Precursor Sequence 
g   a  g       gaa        cu       a     ggca
 cca gg uuugggg   cauucaac  gucggug guuug    g
 ||| || |||||||   ||||||||  ||||||| |||||     c
 ggu cc gagcccc   gugaguug  cagcuac caaac    u
a   -  g       -ag        -c       -     agac

References

  • Sex-dependent phosphorylation of Argonaute 2 reduces the mitochondrial translocation of miR-181c and induces cardioprotection in females. Quiroga D, Roman B, Salih M, Daccarett-Bojanini WN, Garbus H, Ebenebe OV, Dodd-O JM, O'Rourke B, Kohr M, Das S. J Mol Cell Cardiol. 2024 Sep;194:59-69.

  • Downregulation of miR-181c-5p in Alzheimer's disease weakens the response of microglia to Aβ phagocytosis. Li R, Yao S, Wei F, Chen M, Zhong Y, Zou C, Chen L, Wei L, Yang C, Zhang X, Liu Y. Sci Rep. 2024 May 20;14(1):11487.

  • MiR-181c-5p ameliorates learning and memory in sleep-deprived mice via HMGB1/TLR4/NF-κB pathway. Hu Y, Hu C, Yin J, Zhong J, Deng Y, Yang G. An Acad Bras Cienc. 2023 Jul 17;95(suppl 1):e20220750.

  • The miR-181 family regulates colonic inflammation through its activity in the intestinal epithelium. Jimenez MT, Clark ML, Wright JM, Michieletto MF, Liu S, Erickson I, Dohnalova L, Uhr GT, Tello-Cajiao J, Joannas L, Williams A, Gagliani N, Bewtra M, Tomov VT, Thaiss CA, Henao-Mejia J. J Exp Med. 2022 Dec 5;219(12):e20212278.

  • PACT establishes a posttranscriptional brake on mitochondrial biogenesis by promoting the maturation of miR-181c. Dogan AE, Hamid SM, Yildirim AD, Yildirim Z, Sen G, Riera CE, Gottlieb RA, Erbay E. J Biol Chem. 2022 Jul;298(7):102050.

  • Role of miR-181c in Diet-induced obesity through regulation of lipid synthesis in liver. Akiyoshi K, Boersma GJ, Johnson MD, Velasquez FC, Dunkerly-Eyring B, O'Brien S, Yamaguchi A, Steenbergen C, Tamashiro KLK, Das S. PLoS One. 2021 Dec 8;16(12):e0256973.

  • Long‑chain non‑coding RNA Xu T, Xu X, Chu Y, Jiang D, Xu G. Int J Mol Med. 2021 Dec;48(6):209.

  • CircPTK2-miR-181c-5p-HMGB1: a new regulatory pathway for microglia activation and hippocampal neuronal apoptosis induced by sepsis. Li M, Hu J, Peng Y, Li J, Ren R. Mol Med. 2021 May 5;27(1):45.

  • Long non-coding RNA 00507/miRNA-181c-5p/TTBK1/MAPT axis regulates tau hyperphosphorylation in Alzheimer's disease. Yan Y, Yan H, Teng Y, Wang Q, Yang P, Zhang L, Cheng H, Fu S. J Gene Med. 2020 Dec;22(12):e3268.

  • Nuclear-mitochondrial communication involving miR-181c plays an important role in cardiac dysfunction during obesity. Roman B, Kaur P, Ashok D, Kohr M, Biswas R, O'Rourke B, Steenbergen C, Das S. J Mol Cell Cardiol. 2020 Jul;144:87-96.

  • Micro RNA 181c-5p: A promising target for post-stroke recovery in socially isolated mice. Antony M, Scranton V, Srivastava P, Verma R. Neurosci Lett. 2020 Jan 10;715:134610.

  • Developmental conservation of microRNA gene localization at the nuclear periphery. Salataj E, Stathopoulou C, Hafþórsson RA, Nikolaou C, Spilianakis CG. PLoS One. 2019 Nov 4;14(11):e0223759.

  • The lncRNA Malat1 functions as a ceRNA to contribute to berberine-mediated inhibition of HMGB1 by sponging miR-181c-5p in poststroke inflammation. Cao DW, Liu MM, Duan R, Tao YF, Zhou JS, Fang WR, Zhu JR, Niu L, Sun JG. Acta Pharmacol Sin. 2020 Jan;41(1):22-33.

  • LncRNA SNHG6 functions as a ceRNA to regulate neuronal cell apoptosis by modulating miR-181c-5p/BIM signalling in ischaemic stroke. Zhang X, Liu Z, Shu Q, Yuan S, Xing Z, Song J. J Cell Mol Med. 2019 Sep;23(9):6120-6130.

  • The gut microbiota regulates white adipose tissue inflammation and obesity via a family of microRNAs. Virtue AT, McCright SJ, Wright JM, Jimenez MT, Mowel WK, Kotzin JJ, Joannas L, Basavappa MG, Spencer SP, Clark ML, Eisennagel SH, Williams A, Levy M, Manne S, Henrickson SE, Wherry EJ, Thaiss CA, Elinav E, Henao-Mejia J. Sci Transl Med. 2019 Jun 12;11(496):eaav1892.

  • miR-181c-5p mediates simulated microgravity-induced impaired osteoblast proliferation by promoting cell cycle arrested in the G Sun Z, Li Y, Wang H, Cai M, Gao S, Liu J, Tong L, Hu Z, Wang Y, Wang K, Zhang L, Cao X, Zhang S, Shi F, Zhao J. J Cell Mol Med. 2019 May;23(5):3302-3316.

  • miR-181c protects CsA-induced renal damage and fibrosis through inhibiting EMT. Sun W, Min B, Du D, Yang F, Meng J, Wang W, Zhao J, Tan X, Li Z, Sun J. FEBS Lett. 2017 Nov;591(21):3588-3599.

  • MiR-181c restrains nitration stress of endothelial cells in diabetic db/db mice through inhibiting the expression of FoxO1. Yang G, Wu Y, Ye S. Biochem Biophys Res Commun. 2017 Apr 22;486(1):29-35.

  • Deregulation of miRNA-181c potentially contributes to the pathogenesis of AD by targeting collapsin response mediator protein 2 in mice. Zhou H, Zhang R, Lu K, Yu W, Xie B, Cui D, Jiang L, Zhang Q, Xu S. J Neurol Sci. 2016 Aug 15;367:3-10.

  • MicroRNA-181 promotes synaptogenesis and attenuates axonal outgrowth in cortical neurons. Kos A, Olde Loohuis N, Meinhardt J, van Bokhoven H, Kaplan BB, Martens GJ, Aschrafi A. Cell Mol Life Sci. 2016 Sep;73(18):3555-67.

    • There are 44 references associated with mmu-miR-181c-3p. Click here to see the complete list in PubMed.