Mature miRNA: mmu-miR-17-5p

Mature miRNA

miRNA Name mmu-miR-17-5p
Previous Name mmu-miR-17-5p;mmu-miR-17
miRNA Sequence 5' - caaagugcuuacagugcagguag - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000649
Similar miRNAs mmu-miR-106a-5p, mmu-miR-106b-5p, mmu-miR-20a-5p, mmu-miR-20b-5p, mmu-miR-6383, mmu-miR-93-5p (sharing the same seed sequence with mmu-miR-17-5p).

Precursor miRNA

Precursor Name mmu-mir-17
Genomic Location chr14:115043671-115043754 (+); nearby genomic features
Clustered miRNAs mmu-mir-17,mmu-mir-18a,mmu-mir-19a,mmu-mir-20a,mmu-mir-19b-1,mmu-mir-92a-1 (within 10kb in genome)
NCBI GENE ID 723905
miRBase ID MI0000687
Precursor Sequence 
     a       -ca       ua  g     guagu    u
gucag auaaugu   aagugcu  ca ugcag     gaug g
||||| |||||||   |||||||  || |||||     |||| 
caguc uauuacg   uucacgg  gu acguc     cuac u
     g       aug       ga  g     ---au    g

References

  • Suppression of miR-17 Alleviates Acute Respiratory Distress-associated Lung Fibrosis by Regulating Mfn2. Xu MX, Xu T, An N. Curr Med Sci. 2024 Oct;44(5):964-970.

  • EVs-miR-17-5p attenuates the osteogenic differentiation of vascular smooth muscle cells potentially via inhibition of TGF-β signaling under high glucose conditions. Baba I, Matoba T, Katsuki S, Koga JI, Kawahara T, Kimura M, Akita H, Tsutsui H. Sci Rep. 2024 Jul 15;14(1):16323.

  • MicroRNA‑17‑5p alleviates sepsis‑related acute kidney injury in mice by modulating inflammation and apoptosis. Sun J, Niu L, Wang Y, Zhao G, Tang L, Jiang J, Pan S, Ge X. Mol Med Rep. 2024 Aug;30(2):139.

  • Mechanism of lncRNA HOTAIR in attenuating cardiomyocyte pyroptosis in mice with heart failure via the miR-17-5p/RORA axis. He L, Lu F, Zhang F, Fan S, Xu J. Exp Cell Res. 2023 Dec 15;433(2):113806.

  • Neuronal miR-17-5p contributes to interhemispheric cortical connectivity defects induced by prenatal alcohol exposure. Altounian M, Bellon A, Mann F. Cell Rep. 2023 Sep 26;42(9):113020.

  • MYC regulates CSF1 expression via microRNA 17/20a to modulate tumor-associated macrophages in osteosarcoma. Nirala BK, Patel TD, Kurenbekova L, Shuck R, Dasgupta A, Rainusso N, Coarfa C, Yustein JT. JCI Insight. 2023 Jul 10;8(13):e164947.

  • miR-17-5p slows progression of hepatocellular carcinoma by downregulating TGFβR2. Liu HT, Luo CP, Jiang MJ, Deng ZJ, Teng YX, Su JY, Pan LX, Ma L, Guo PP, Zhong JH. Clin Transl Oncol. 2023 Oct;25(10):2960-2971.

  • MiR-17-5p Mediates the Effects of ACE2-Enriched Endothelial Progenitor Cell-Derived Exosomes on Ameliorating Cerebral Ischemic Injury in Aged Mice. Pan Q, Wang Y, Liu J, Jin X, Xiang Z, Li S, Shi Y, Chen Y, Zhong W, Ma X. Mol Neurobiol. 2023 Jun;60(6):3534-3552.

  • Exosomes of Adipose Tissue-Derived Stem Cells Promote Wound Healing by Sponging miR-17-5p and Inducing Autophagy Protein Ulk1. An Y, Huang F, Tan X, Zhu S, Zhen Y, Shang Y, Ding P, Li D, Wu J. Plast Reconstr Surg. 2023 May 1;151(5):1016-1028.

  • Exosomal miR-17-5p from adipose-derived mesenchymal stem cells inhibits abdominal aortic aneurysm by suppressing TXNIP-NLRP3 inflammasome. Hu J, Jiang Y, Wu X, Wu Z, Qin J, Zhao Z, Li B, Xu Z, Lu X, Wang X, Liu X. Stem Cell Res Ther. 2022 Jul 26;13(1):349.

  • [Molecular mechanism of astragaloside â…£ against atherosclerosis by regulating miR-17-5p and PCSK9/VLDLR signal pathway]. Qin HW, Zhang QS, Li YJ, Li WT, Wang Y. Zhongguo Zhong Yao Za Zhi. 2022 Jan;47(2):492-498.

  • Exosomal miR-17-3p Alleviates Programmed Necrosis in Cardiac Ischemia/Reperfusion Injury by Regulating TIMP3 Expression. Liu Z, Zhu D, Yu F, Yang M, Huang D, Ji Z, Lu W, Ma G. Oxid Med Cell Longev. 2022 Jan 25;2022:2785113.

  • microRNA-17-5p downregulation inhibits autophagy and myocardial remodelling after myocardial infarction by targeting STAT3. Chen B, Yang Y, Wu J, Song J, Lu J. Autoimmunity. 2022 Feb;55(1):43-51.

  • Elevated Expression of MiR-17 in Microglia of Alzheimer's Disease Patients Abrogates Autophagy-Mediated Amyloid-β Degradation. Estfanous S, Daily KP, Eltobgy M, Deems NP, Anne MNK, Krause K, Badr A, Hamilton K, Carafice C, Hegazi A, Abu Khweek A, Kelani H, Nimjee S, Awad H, Zhang X, Cormet-Boyaka E, Haffez H, Soror S, Mikhail A, Nuovo G, Barrientos RM, Gavrilin MA, Amer AO. Front Immunol. 2021 Jul 27;12:705581.

  • DNA Methyltransferase 1 Is Dysregulated in Parkinson's Disease via Mediation of miR-17. Zhang HQ, Wang JY, Li ZF, Cui L, Huang SS, Zhu LB, Sun Y, Yang R, Fan HH, Zhang X, Zhu JH. Mol Neurobiol. 2021 Jun;58(6):2620-2633.

  • MiR-17-3p inhibits osteoblast differentiation by downregulating Sox6 expression. Chen N, Wu D, Li H, Liu Y, Yang H. FEBS Open Bio. 2020 Nov;10(11):2499-2506.

  • MiR-17-5p-mediated endoplasmic reticulum stress promotes acute myocardial ischemia injury through targeting Tsg101. Zhao L, Jiang S, Wu N, Shi E, Yang L, Li Q. Cell Stress Chaperones. 2021 Jan;26(1):77-90.

  • Epigenetic repression of miR-17 contributed to di(2-ethylhexyl) phthalate-triggered insulin resistance by targeting Keap1-Nrf2/miR-200a axis in skeletal muscle. Wei J, Hao Q, Chen C, Li J, Han X, Lei Z, Wang T, Wang Y, You X, Chen X, Li H, Ding Y, Huang W, Hu Y, Lin S, Shen H, Lin Y. Theranostics. 2020 Jul 23;10(20):9230-9248.

  • miR17-92 cluster drives white adipose tissue browning. Huang Y, Zhang H, Dong M, Zhang L, Lin J, Ye R, Zhou H, Liu X, Jin W. J Mol Endocrinol. 2020 Oct;65(3):97-107.

  • MiR-17 Knockdown Promotes Vascular Smooth Muscle Cell Phenotypic Modulation Through Upregulated Interferon Regulator Factor 9 Expression. Li W, Deng P, Wang J, Li Z, Zhang H. Am J Hypertens. 2020 Dec 31;33(12):1119-1126.

    • There are 130 references associated with mmu-miR-17-5p. Click here to see the complete list in PubMed.