Mature miRNA: mmu-miR-151-5p

Mature miRNA

miRNA Name mmu-miR-151-5p
miRNA Sequence 5' - ucgaggagcucacagucuagu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004536

Precursor miRNA

Precursor Name mmu-mir-151
Genomic Location chr15:73254815-73254882 (-); nearby genomic features
NCBI GENE ID 387169
miRBase ID MI0000173
Precursor Sequence 
    c            ca          u uc
ccug ccucgaggagcu  cagucuagua g  u
|||| ||||||||||||  |||||||||| |   c
ggac ggaguuccucgg  gucagaucau c  c
    a            -a          c cu

References

  • Upregulation of miR-151-5p promotes the apoptosis of intestinal epithelial cells by targeting brain-derived neurotrophic factor in ulcerative colitis mice. Zhou F, Chen L, Xu S, Si C, Li N, Dong H, Zheng P, Wang W. Cell Cycle. 2022 Dec;21(24):2615-2626.

  • miR-151-5p modulates APH1a expression to participate in contextual fear memory formation. Xu XF, Wang YC, Zong L, Wang XL. RNA Biol. 2019 Mar;16(3):282-294.

  • MicroRNA in vivo precipitation identifies miR-151-3p as a computational unpredictable miRNA to target Stat3 and inhibits innate IL-6 production. Liu X, Su X, Xu S, Wang H, Han D, Li J, Huang M, Cao X. Cell Mol Immunol. 2018 Feb;15(2):99-110.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • microRNA-151-3p regulates slow muscle gene expression by targeting ATP2a2 in skeletal muscle cells. Wei H, Li Z, Wang X, Wang J, Pang W, Yang G, Shen QW. J Cell Physiol. 2015 May;230(5):1003-12.

  • Regulation of microRNA-mediated gene silencing by microRNA precursors. Roy-Chaudhuri B, Valdmanis PN, Zhang Y, Wang Q, Luo QJ, Kay MA. Nat Struct Mol Biol. 2014 Sep;21(9):825-32.

  • Baculovirus-mediated miRNA regulation to suppress hepatocellular carcinoma tumorigenicity and metastasis. Chen CL, Wu JC, Chen GY, Yuan PH, Tseng YW, Li KC, Hwang SM, Hu YC. Mol Ther. 2015 Jan;23(1):79-88.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Reprogramming of microRNAs by adenosine-to-inosine editing and the selective elimination of edited microRNA precursors in mouse oocytes and preimplantation embryos. García-López J, Hourcade Jde D, Del Mazo J. Nucleic Acids Res. 2013 May 1;41(10):5483-93.

  • A-to-I editing of microRNAs in the mammalian brain increases during development. Ekdahl Y, Farahani HS, Behm M, Lagergren J, Öhman M. Genome Res. 2012 Aug;22(8):1477-87.

  • Isolation of fetal gonads from embryos of timed-pregnant mice for morphological and molecular studies. Li Y, Taketo T, Lau YF. Methods Mol Biol. 2012;825:3-16.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • Global analysis of the mammalian RNA degradome reveals widespread miRNA-dependent and miRNA-independent endonucleolytic cleavage. Bracken CP, Szubert JM, Mercer TR, Dinger ME, Thomson DW, Mattick JS, Michael MZ, Goodall GJ. Nucleic Acids Res. 2011 Jul;39(13):5658-68.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Difference in expression of hepatic microRNAs miR-29c, miR-34a, miR-155, and miR-200b is associated with strain-specific susceptibility to dietary nonalcoholic steatohepatitis in mice. Pogribny IP, Starlard-Davenport A, Tryndyak VP, Han T, Ross SA, Rusyn I, Beland FA. Lab Invest. 2010 Oct;90(10):1437-46.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Unintentional miRNA ablation is a risk factor in gene knockout studies: a short report. Osokine I, Hsu R, Loeb GB, McManus MT. PLoS Genet. 2008 Feb;4(2):e34.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • RNA editing of the microRNA-151 precursor blocks cleavage by the Dicer-TRBP complex. Kawahara Y, Zinshteyn B, Chendrimada TP, Shiekhattar R, Nishikura K. EMBO Rep. 2007 Aug;8(8):763-9.

    • There are 24 references associated with mmu-miR-151-5p. Click here to see the complete list in PubMed.