Mature miRNA: mmu-miR-150-3p

Mature miRNA

miRNA Name mmu-miR-150-3p
Previous Name mmu-miR-150*
miRNA Sequence 5' - cugguacaggccugggggauag - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004535

Precursor miRNA

Precursor Name mmu-mir-150
Genomic Location chr7:45121757-45121821 (+); nearby genomic features
Clustered miRNAs mmu-mir-150,mmu-mir-5121 (within 10kb in genome)
NCBI GENE ID 387168
miRBase ID MI0000172
Precursor Sequence 
            ac   u       u -   u
cccugucuccca  ccu guaccag g cug g
||||||||||||  ||| ||||||| | |||  c
gggauagggggu  gga caugguc c gac c
            cc   -       c a   u

References

  • DEmiRNA-mRNA regulatory network reveals miR-122-5p as a regulatory factor of arginine metabolism in necrotizing enterocolitis. Ding Z, Guo T, Tang Q, Hong Y, Lv Z, Lu L, Zhuang W. Front Genet. 2025 Jan 22;15:1480431.

  • mir-150-5p inhibits the osteogenic differentiation of bone marrow-derived mesenchymal stem cells by targeting irisin to regulate the p38/MAPK signaling pathway. Qi JL, Zhang ZD, Dong Z, Shan T, Yin ZS. J Orthop Surg Res. 2024 Mar 18;19(1):190.

  • MiR-150 levels are related to in-hospital mortality in non-HIV Pneumocystis pneumonia patients. Zhang C, Sun H, Zhang QY, Tong ZH. Med Mycol. 2024 May 3;62(5):myae022.

  • MicroRNA-150 Deletion Reduces the Occurrence and Severity of Rheumatoid Arthritis by Inhibiting IL-17. Zhang A, Zheng Q. Iran J Immunol. 2024 Mar 12;21(1):89-100.

  • Inhibition of myocardial remodeling through miR-150/TET3 axis after AMI. Lu W, Liu Z, Chiara Villamil Orion IR, Qu Y, Ma G. Mol Biol Rep. 2023 Dec 28;51(1):32.

  • MiR-150-5p contributes to unexplained recurrent spontaneous abortion by targeting VEGFA and downregulating the PI3K/AKT/mTOR signaling pathway. Liao W, Deng X, Chen G, Yang J, Li Y, Li L, Zhong L, Tao G, Hou J, Li M, Ding C. J Assist Reprod Genet. 2024 Jan;41(1):63-77.

  • SPRR1A is a key downstream effector of MiR-150 during both maladaptive cardiac remodeling in mice and human cardiac fibroblast activation. Kawaguchi S, Moukette B, Sepúlveda MN, Hayasaka T, Aonuma T, Haskell AK, Mah J, Liangpunsakul S, Tang Y, Conway SJ, Kim IM. Cell Death Dis. 2023 Jul 19;14(7):446.

  • Agomir miRNA-150-5p alleviates pristane-induced lupus by suppressing myeloid dendritic cells activation and inflammation via TREM-1 axis. Yue C, Wang W, Gao S, Ye J, Zhang T, Xing Z, Xie Y, Qian H, Zhou X, Li S, Yu A, Wang L, Wang J, Hua C. Inflamm Res. 2023 Jul;72(7):1391-1408.

  • Mesenchymal Stem Cell-Derived Exosomal miR-150-3p Affects Intracerebral Hemorrhage By Regulating TRAF6/NF-κB Axis, Gut Microbiota and Metabolism. Sun J, Xu G. Stem Cell Rev Rep. 2023 Aug;19(6):1907-1921.

  • Antigen-specific downregulation of miR-150 in CD4 T cells promotes cell survival. Ménoret A, Agliano F, Karginov TA, Karlinsey KS, Zhou B, Vella AT. Front Immunol. 2023 Jan 27;14:1102403.

  • Long non-coding RNA MALAT1 aggravated liver ischemia-reperfusion injury via targeting miR-150-5p/AZIN1. Sun Q, Gong J, Gong X, Wu J, Hu Z, Zhang Q, Zhu X. Bioengineered. 2022 May;13(5):13422-13436.

  • MicroRNA-150-5p is upregulated in the brain microvasculature during prenatal alcohol exposure and inhibits the angiogenic factor Vezf1. Perales G, Westenskow M, Gutierrez R, Caldwell KK, Allan AM, Gardiner AS. Alcohol Clin Exp Res. 2022 Nov;46(11):1953-1966.

  • Exercise-Linked Skeletal Irisin Ameliorates Diabetes-Associated Osteoporosis by Inhibiting the Oxidative Damage-Dependent miR-150-FNDC5/Pyroptosis Axis. Behera J, Ison J, Voor MJ, Tyagi N. Diabetes. 2022 Dec 1;71(12):2777-2792.

  • Transplantation of bone marrow cells from miR150 knockout mice improves senescence-associated humoral immune dysfunction and arterial stiffness. Fan J, Wang S, Lu X, Sun Z. Metabolism. 2022 Sep;134:155249.

  • MiR-150 Attenuates Maladaptive Cardiac Remodeling Mediated by Long Noncoding RNA MIAT and Directly Represses Profibrotic Aonuma T, Moukette B, Kawaguchi S, Barupala NP, Sepúlveda MN, Frick K, Tang Y, Guglin M, Raman SV, Cai C, Liangpunsakul S, Nakagawa S, Kim IM. Circ Heart Fail. 2022 Apr;15(4):e008686.

  • MiR-150-5p regulates the functions of type 2 innate lymphoid cells via the ICAM-1/p38 MAPK axis in allergic rhinitis. Zhang L, Meng W, Chen X, Ning Y, Sun M, Wang R. Mol Cell Biochem. 2022 Apr;477(4):1009-1022.

  • The long noncoding RNA GAS5 potentiates neuronal injury in Parkinson's disease by binding to microRNA-150 to regulate Fosl1 expression. Ma J, Sun W, Chen S, Wang Z, Zheng J, Shi X, Li M, Li D, Gu Q. Exp Neurol. 2022 Jan;347:113904.

  • MicroRNA-150 and its target ETS-domain transcription factor 1 contribute to inflammation in diabetic photoreceptors. Yu F, Ko ML, Ko GY. J Cell Mol Med. 2021 Nov;25(22):10724-10735.

  • Inhibition of the long non-coding RNA ZFAS1 attenuates ferroptosis by sponging miR-150-5p and activates CCND2 against diabetic cardiomyopathy. Ni T, Huang X, Pan S, Lu Z. J Cell Mol Med. 2021 Nov;25(21):9995-10007.

  • Cardiomyocyte microRNA-150 confers cardiac protection and directly represses proapoptotic small proline-rich protein 1A. Aonuma T, Moukette B, Kawaguchi S, Barupala NP, Sepúlveda MN, Corr C, Tang Y, Liangpunsakul S, Payne RM, Willis MS, Kim IM. JCI Insight. 2021 Sep 22;6(18):e150405.

    • There are 112 references associated with mmu-miR-150-3p. Click here to see the complete list in PubMed.