Mature miRNA: mmu-miR-126a-3p

Mature miRNA

miRNA Name mmu-miR-126a-3p
miRNA Sequence 5' - ucguaccgugaguaauaaugcg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000138

Precursor miRNA

Precursor Name mmu-mir-126a
Genomic Location chr2:26591357-26591429 (+); nearby genomic features
Clustered miRNAs mmu-mir-126a,mmu-mir-126b (within 10kb in genome)
NCBI GENE ID 387145
miRBase ID MI0000153
Precursor Sequence 
u   a  a           u       c cug   c
 gac gc cauuauuacuu ugguacg g   uga a
 ||| || ||||||||||| ||||||| |   ||| 
 cug cg guaauaaugag gccaugc c   acu c
a   g  c           u       u -aa   u

References

  • MiR-126 accelerates renal injury induced by UUO via inhibition PI3K/ IRS-1/ FAK signaling induced M2 polarization and endocytosis in macrophages. Luo X, Zhang L, Han G, Lu P, Zhang Y. Sci Rep. 2024 Oct 30;14(1):26083.

  • miR-126a-5p inhibits H1N1-induced inflammation and matrix protease secretion in lung fibroblasts by targeting ADAMTS-4. Fang F, Wang B, Lu X, Wang L, Chen X, Wang G, Yang Y. Arch Virol. 2024 Jul 11;169(8):164.

  • Intraplatelet miRNA-126 regulates thrombosis and its reduction contributes to platelet inhibition. Zhang LJ, Hu YX, Huang RZ, Xu YY, Dong SH, Guo FH, Guo JJ, Qiu JJ, Cao ZY, Wei LJ, Mao JH, Lyu A, Liu JL, Zhao XX, Guo ZF, Jing Q. Cardiovasc Res. 2024 Nov 5;120(13):1622-1635.

  • Hsa_circ_0002348 regulates trophoblast proliferation and apoptosis through miR-126-3p/BAK1 axis in preeclampsia. Zhou J, Zhao Y, An P, Zhao H, Li X, Xiong Y. J Transl Med. 2023 Jul 28;21(1):509.

  • Steatotic hepatocyte-derived extracellular vesicles promote β-cell apoptosis and diabetes via microRNA-126a-3p. Chen Q, Jiang FJ, Gao X, Li XY, Xia P. Liver Int. 2023 Nov;43(11):2560-2570.

  • MicroRNA-126 regulates macrophage polarization to prevent the resorption of alveolar bone in diabetic periodontitis. Li J, Liu Y, Lai W, Song L, Deng J, Li C, Jiang S. Arch Oral Biol. 2023 Jun;150:105686.

  • Microglia Regulate Blood-Brain Barrier Integrity via MiR-126a-5p/MMP9 Axis during Inflammatory Demyelination. Yu Z, Fang X, Liu W, Sun R, Zhou J, Pu Y, Zhao M, Sun D, Xiang Z, Liu P, Ding Y, Cao L, He C. Adv Sci (Weinh). 2022 Aug;9(24):e2105442.

  • miR-126 downregulates CXCL12 expression in intestinal epithelial cells to suppress the recruitment and function of macrophages and tumorigenesis in a murine model of colitis-associated colorectal cancer. Wu S, Yuan W, Luo W, Nie K, Wu X, Meng X, Shen Z, Wang X. Mol Oncol. 2022 Oct;16(19):3465-3489.

  • The Recombinant Du X, Zhu M, Zhang T, Wang C, Tao J, Yang S, Zhu Y, Zhao W. Front Immunol. 2022 Feb 8;13:773276.

  • miRNA-126a-3p participates in hippocampal memory via alzheimer's disease-related proteins. Xue B, Qu Y, Zhang X, Xu XF. Cereb Cortex. 2022 Oct 20;32(21):4763-4781.

  • Single-Cell Transcriptome Analysis Reveals Embryonic Endothelial Heterogeneity at Spatiotemporal Level and Multifunctions of MicroRNA-126 in Mice. Guo FH, Guan YN, Guo JJ, Zhang LJ, Qiu JJ, Ji Y, Chen AF, Jing Q. Arterioscler Thromb Vasc Biol. 2022 Mar;42(3):326-342.

  • MircoRNA-126-5p inhibits apoptosis of endothelial cell in vascular arterial walls via NF-κB/PI3K/AKT/mTOR signaling pathway in atherosclerosis. Jia W, Liu J, Tian X, Jiang P, Cheng Z, Meng C. J Mol Histol. 2022 Feb;53(1):51-62.

  • MiR-126-HMGB1-HIF-1 Axis Regulates Endothelial Cell Inflammation during Exposure to Hypoxia-Acidosis. Liu J, Wei E, Wei J, Zhou W, Webster KA, Zhang B, Li D, Zhang G, Wei Y, Long Y, Qi X, Zhang Q, Xu D. Dis Markers. 2021 Dec 21;2021:4933194.

  • Decreased microRNA-126 expression in psoriatic CD4 Wu R, Li X, Li S, Tang G, Zhang S, Zhu Y, Zhang X, Deng M, Tan S, Luo S, Zhang Q, Zhao M, Zhang P, Su Y. J Dermatol. 2022 Apr;49(4):432-440.

  • Treatment-induced arteriolar revascularization and miR-126 enhancement in bone marrow niche protect leukemic stem cells in AML. Zhang B, Nguyen LXT, Zhao D, Frankhouser DE, Wang H, Hoang DH, Qiao J, Abundis C, Brehove M, Su YL, Feng Y, Stein A, Ghoda L, Dorrance A, Perrotti D, Chen Z, Han A, Pichiorri F, Jin J, Jovanovic-Talisman T, Caligiuri MA, Kuo CJ, Yoshimura A, Li L, Rockne RC, Kortylewski M, Zheng Y, Carlesso N, Kuo YH, Marcucci G. J Hematol Oncol. 2021 Aug 9;14(1):122.

  • BNIP3-Dependent Mitophagy via PGC1α Promotes Cartilage Degradation. Kim D, Song J, Jin EJ. Cells. 2021 Jul 20;10(7):1839.

  • The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL, Amendt BA. Stem Cells. 2021 Jun;39(6):761-775.

  • Hepatic microRNA-126 deficiency restrains liver regeneration through p53 pathway in mice. Zhang L, Qiu Y, Yang F, Yao J, Wang Y, Qin Y, Mou H, Jing Q, Liu L, Ju Z. Signal Transduct Target Ther. 2021 Jan 28;6(1):32.

  • Maternal obesity during pregnancy leads to adipose tissue ER stress in mice via miR-126-mediated reduction in Lunapark. de Almeida-Faria J, Duque-Guimarães DE, Ong TP, Pantaleão LC, Carpenter AA, Loche E, Kusinski LC, Ashmore TJ, Antrobus R, Bushell M, Fernandez-Twinn DS, Ozanne SE. Diabetologia. 2021 Apr;64(4):890-902.

  • LncRNA HOTAIR aggravates myocardial ischemia-reperfusion injury by sponging microRNA-126 to upregulate SRSF1. Sun Y, Hu ZQ. Eur Rev Med Pharmacol Sci. 2020 Sep;24(17):9046-9054.

    • There are 116 references associated with mmu-miR-126a-3p. Click here to see the complete list in PubMed.