Mature miRNA: mmu-miR-122-5p

Mature miRNA

miRNA Name mmu-miR-122-5p
Previous Name mmu-miR-122a;mmu-miR-122
miRNA Sequence 5' - uggagugugacaaugguguuug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000246

Precursor miRNA

Precursor Name mmu-mir-122
Genomic Location chr18:65248861-65248926 (+); nearby genomic features
Clustered miRNAs mmu-mir-122,mmu-mir-122b (within 10kb in genome)
NCBI GENE ID 387231
miRBase ID MI0000256
Precursor Sequence 
      gg       c           -  uc
agcugu  aguguga aaugguguuug ug  c
||||||  ||||||| ||||||||||| ||   a
ucgaua  ucacacu uuaccgcaaac ac  a
      aa       a           u  ca

References

  • DEmiRNA-mRNA regulatory network reveals miR-122-5p as a regulatory factor of arginine metabolism in necrotizing enterocolitis. Ding Z, Guo T, Tang Q, Hong Y, Lv Z, Lu L, Zhuang W. Front Genet. 2025 Jan 22;15:1480431.

  • Glucose metabolism disorder related to follicular fluid exosomal miR-122-5p in cumulus cells of endometriosis patients. Zhang J, Li K, Gao L, Zhu P, Shu L, Cai L, Diao F, Mao Y. Reproduction. 2024 Sep 11;168(4):e240028.

  • Dysregulated expression of miR-140 and miR-122 compromised microglial chemotaxis and led to reduced restriction of AD pathology. Song C, Li S, Mai Y, Li L, Dai G, Zhou Y, Liang X, Zou OM, Wang Y, Zhou L, Liu J, Zou Y. J Neuroinflammation. 2024 Jul 2;21(1):167.

  • Limiting viral replication in hepatocytes alters Rift Valley fever virus disease manifestations. Xu L, Paine AC, Barbeau DJ, Alencastro F, Duncan AW, McElroy AK. J Virol. 2023 Sep 28;97(9):e0085323.

  • MicroRNA-122-5p alleviates endometrial fibrosis via inhibiting the TGF-β/SMAD pathway in Asherman's syndrome. Chen S, Ma Y, Qiu X, Liu M, Zhang P, Wei C, Dai Y, Ge L, Zhu H, Zhang Y, Zhang J, Lin X. Reprod Biomed Online. 2023 Nov;47(5):103253.

  • miR-122-3p Alleviates LPS-Induced Pyroptosis of Macrophages via Targeting NLRP1. Li M, Hu L, Ke Q, Ruan C, Liu X. Ann Clin Lab Sci. 2023 Jul;53(4):578-586.

  • miR-122-5p Promotes Peripheral and Central Nervous System Inflammation in a Mouse Model of Intracerebral Hemorrhage via Disruption of the MLLT1/PI3K/AKT Signaling. Yu N, Tian W, Liu C, Zhang P, Zhao Y, Nan C, Jin Q, Li X, Liu Y. Neurochem Res. 2023 Dec;48(12):3665-3682.

  • The protective effect of lncRNA NEAT1/miR-122-5p/Wnt1 axis on hippocampal damage in hepatic ischemic reperfusion young mice. Dong Z, Jia L, Han W, Wang Y, Sheng M, Ren Y, Weng Y, Li H, Yu W. Cell Signal. 2023 Jul;107:110668.

  • Inhibition of MicroRNA-122-5p Relieves Myocardial Ischemia-Reperfusion Injury via SOCS1. Zhang J, Fu L, Zhang J, Zhou B, Tang Y, Zhang Z, Gu T. Hamostaseologie. 2023 Aug;43(4):271-280.

  • AUF-1 knockdown in mice undermines gut microbial butyrate-driven hypocholesterolemia through AUF-1-Dicer-1-mir-122 hierarchy. Das O, Kundu J, Ghosh A, Gautam A, Ghosh S, Chakraborty M, Masid A, Gauri SS, Mitra D, Dutta M, Mukherjee B, Sinha S, Bhaumik M. Front Cell Infect Microbiol. 2022 Dec 19;12:1011386.

  • miR-122-5p Regulates Renal Fibrosis In Vivo. Kaneko S, Yanai K, Ishii H, Aomatsu A, Hirai K, Ookawara S, Ishibashi K, Morishita Y. Int J Mol Sci. 2022 Dec 6;23(23):15423.

  • Prenatal arsenic exposure stymies gut butyrate production and enhances gut permeability in post natal life even in absence of arsenic deftly through miR122-Occludin pathway. Chakraborty M, Gautam A, Das O, Masid A, Bhaumik M. Toxicol Lett. 2023 Feb 1;374:19-30.

  • MicroRNA-122a aggravates intestinal ischemia/reperfusion injury by promoting pyroptosis via targeting EGFR-NLRP3 signaling pathway. Wang F, Gu L, Wang Y, Sun D, Zhao Y, Meng Q, Yin L, Xu L, Lu X, Peng J, Lin Y, Sun P. Life Sci. 2022 Oct 15;307:120863.

  • Dysregulation of Lipid and Glucose Homeostasis in Hepatocyte-Specific SLC25A34 Knockout Mice. Roy N, Alencastro F, Roseman BA, Wilson SR, Delgado ER, May MC, Bhushan B, Bello FM, Jurczak MJ, Shiva S, Locker J, Gingras S, Duncan AW. Am J Pathol. 2022 Sep;192(9):1259-1281.

  • Downregulation of miR-122-5p Activates Glycolysis via PKM2 in Kupffer Cells of Rat and Mouse Models of Non-Alcoholic Steatohepatitis. Inomata Y, Oh JW, Taniguchi K, Sugito N, Kawaguchi N, Hirokawa F, Lee SW, Akao Y, Takai S, Kim KP, Uchiyama K. Int J Mol Sci. 2022 May 7;23(9):5230.

  • Interleukin-17 programs liver progenitor cell transformation into cancer stem cells through miR-122 downregulation with increased risk of primary liver cancer initiation. Gasmi I, Machou C, Rodrigues A, Brouillet A, Nguyen TC, Rousseau B, Guillot A, Rodriguez C, Demontant V, Ait-Ahmed Y, Calderaro J, Luciani A, Pawlotsky JM, Lafdil F. Int J Biol Sci. 2022 Feb 21;18(5):1944-1960.

  • microRNA-122 inhibits hepatic stellate cell proliferation and activation in vitro and represses carbon tetrachloride-induced liver cirrhosis in mice. Ma J, Zhao Q, Chen M, Wang W, He B, Jiang Y, Li Y. Ann Hepatol. 2022 Jul-Aug;27(4):100700.

  • Apigenin inhibits isoproterenol-induced myocardial fibrosis and Smad pathway in mice by regulating oxidative stress and miR-122-5p/155-5p expressions. Wang F, Zhang J, Niu G, Weng J, Zhang Q, Xie M, Li C, Sun K. Drug Dev Res. 2022 Jun;83(4):1003-1015.

  • miRNA-122-5p in POI ovarian-derived exosomes promotes granulosa cell apoptosis by regulating BCL9. Zhang X, Zhang R, Hao J, Huang X, Liu M, Lv M, Su C, Mu YL. Cancer Med. 2022 Jun;11(12):2414-2426.

  • miR-137 and miR-122, two outer subventricular zone non-coding RNAs, regulate basal progenitor expansion and neuronal differentiation. Tomasello U, Klingler E, Niquille M, Mule N, Santinha AJ, de Vevey L, Prados J, Platt RJ, Borrell V, Jabaudon D, Dayer A. Cell Rep. 2022 Feb 15;38(7):110381.

    • There are 136 references associated with mmu-miR-122-5p. Click here to see the complete list in PubMed.