Mature miRNA: mmu-miR-10b-5p

Mature miRNA

miRNA Name mmu-miR-10b-5p
Previous Name mmu-miR-10b
miRNA Sequence 5' - uacccuguagaaccgaauuugug - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000208
Similar miRNAs mmu-miR-10a-5p (sharing the same seed sequence with mmu-miR-10b-5p).

Precursor miRNA

Precursor Name mmu-mir-10b
Genomic Location chr2:74726070-74726137 (+); nearby genomic features
NCBI GENE ID 387144
miRBase ID MI0000221
Precursor Sequence 
     a    g     c          -ug  ac
uauau cccu uagaa cgaauuugug   gu  c
||||| |||| ||||| ||||||||||   ||  
auaua gggg aucuu gcuuagacac   ua  c
     a    -     a          uga  ca

References

  • miR-10b-5p rescues leaky gut linked with gastrointestinal dysmotility and diabetes. Zogg H, Singh R, Ha SE, Wang Z, Jin B, Ha M, Dafinone M, Batalon T, Hoberg N, Poudrier S, Nguyen L, Yan W, Layden BT, Dugas LR, Sanders KM, Ro S. United European Gastroenterol J. 2023 Oct;11(8):750-766.

  • Sex-biased gene and microRNA expression in the developing mouse brain is associated with neurodevelopmental functions and neurological phenotypes. Szakats S, McAtamney A, Cross H, Wilson MJ. Biol Sex Differ. 2023 Sep 7;14(1):57.

  • Deficiency of microRNA-10b promotes DSS-induced inflammatory response via impairing intestinal barrier function. Zhao K, Wang C, Liu Y, Li Y, Hui T, Wang G, Zhang X, Xue X, Kang J, Feng G. Biochem Biophys Res Commun. 2022 Dec 25;636(Pt 2):48-54.

  • Adipose mesenchymal stem cell sheets-derived extracellular vesicles-microRNA-10b promote skin wound healing by elevating expression of CDK6. Liao X, Yan F, Hu S, Mu J, Li S, He Y, Tang M, Chen J, Yu L, Sun J. Biomater Adv. 2022 May;136:212781.

  • Multiomic analysis of microRNA-mediated regulation reveals a proliferative axis involving miR-10b in fibrolamellar carcinoma. Francisco AB, Kanke M, Massa AP, Dinh TA, Sritharan R, Vakili K, Bardeesy N, Sethupathy P. JCI Insight. 2022 Jun 8;7(11):e154743.

  • miR-10b promotes aortic aneurysm formation and aortic rupture in angiotensin II-induced ApoE-deficient mice. Wågsäter D, Ramilo AB, Näsström M, Kunath A, Agic MB, Mani K, Wanhainen A, Petri MH. Vascul Pharmacol. 2021 Dec;141:106927.

  • Adverse Maternal Environment Alters MicroRNA-10b-5p Expression and Its Epigenetic Profile Concurrently with Impaired Hippocampal Neurogenesis in Male Mouse Hippocampus. Ke X, Huang Y, Fu Q, Lane RH, Majnik A. Dev Neurosci. 2021;43(2):95-105.

  • miR-10b-5p Rescues Diabetes and Gastrointestinal Dysmotility. Singh R, Ha SE, Wei L, Jin B, Zogg H, Poudrier SM, Jorgensen BG, Park C, Ronkon CF, Bartlett A, Cho S, Morales A, Chung YH, Lee MY, Park JK, Gottfried-Blackmore A, Nguyen L, Sanders KM, Ro S. Gastroenterology. 2021 Apr;160(5):1662-1678.e18.

  • Effect of HIF-1α/miR-10b-5p/PTEN on Hypoxia-Induced Cardiomyocyte Apoptosis. Wu L, Chen Y, Chen Y, Yang W, Han Y, Lu L, Yang K, Cao J. J Am Heart Assoc. 2019 Sep 17;8(18):e011948.

  • Endothelial progenitor cell transplantation attenuates lipopolysaccharide-induced acute lung injury via regulating miR-10a/b-5p. Jin Y, Yang C, Sui X, Cai Q, Guo L, Liu Z. Lipids Health Dis. 2019 Jun 7;18(1):136.

  • miR‑10b‑3p, miR‑8112 and let‑7j as potential biomarkers for autoimmune inner ear diseases. Zhang J, Wang N, Xu A. Mol Med Rep. 2019 Jul;20(1):171-181.

  • miR-10b-5p regulates 3T3-L1 cells differentiation by targeting Apol6. Tan Y, Gan M, Fan Y, Li L, Zhong Z, Li X, Bai L, Zhao Y, Niu L, Shang Y, Zhang S, Zhu L. Gene. 2019 Mar 1;687:39-46.

  • Loss or oncogenic mutation of DROSHA impairs kidney development and function, but is not sufficient for Wilms tumor formation. Kruber P, Angay O, Winkler A, Bösl MR, Kneitz S, Heinze KG, Gessler M. Int J Cancer. 2019 Mar 15;144(6):1391-1400.

  • Apoptotic cell induction of miR-10b in macrophages contributes to advanced atherosclerosis progression in ApoE-/- mice. Wang D, Wang W, Lin W, Yang W, Zhang P, Chen M, Ding D, Liu C, Zheng J, Ling W. Cardiovasc Res. 2018 Nov 1;114(13):1794-1805.

  • Downregulation of miR-10b promotes osteoblast differentiation through targeting Bcl6. Yang J, Wang S, Wang F, Mu X, Qu Y, Zhao Z, Yu X. Int J Mol Med. 2017 Jun;39(6):1605-1612.

  • MicroRNA-10b regulates the renewal of spermatogonial stem cells through Kruppel-like factor 4. Li J, Liu X, Hu X, Tian GG, Ma W, Pei X, Wang Y, Wu J. Cell Biochem Funct. 2017 Apr;35(3):184-191.

  • Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Jiajie T, Yanzhou Y, Hoi-Hung AC, Zi-Jiang C, Wai-Yee C. Sci Rep. 2017 Jan 23;7:41304.

  • Ablation of miR-10b Suppresses Oncogene-Induced Mammary Tumorigenesis and Metastasis and Reactivates Tumor-Suppressive Pathways. Kim J, Siverly AN, Chen D, Wang M, Yuan Y, Wang Y, Lee H, Zhang J, Muller WJ, Liang H, Gan B, Yang X, Sun Y, You MJ, Ma L. Cancer Res. 2016 Nov 1;76(21):6424-6435.

  • miR-1, miR-10b, miR-155, and miR-191 are novel regulators of BDNF. Varendi K, Kumar A, Härma MA, Andressoo JO. Cell Mol Life Sci. 2014 Nov;71(22):4443-56.

  • MicroRNA-10b promotes the migration of mouse bone marrow-derived mesenchymal stem cells and downregulates the expression of E-cadherin. Zhang F, Jing S, Ren T, Lin J. Mol Med Rep. 2013 Oct;8(4):1084-8.

    • There are 40 references associated with mmu-miR-10b-5p. Click here to see the complete list in PubMed.