Mature miRNA: hsa-miR-92b-5p

Mature miRNA

miRNA Name hsa-miR-92b-5p
Previous Name hsa-miR-92b*
miRNA Sequence 5' - agggacgggacgcggugcagug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004792

Precursor miRNA

Precursor Name hsa-mir-92b
Genomic Location chr1:155195177-155195272 (+); nearby genomic features
NCBI GENE ID 693235
miRBase ID MI0003560
Precursor Sequence 
c     cc   c    g     ga       c            uuuuu
 gggcc  ggg gggc ggagg  cgggacg ggugcaguguug     u
 |||||  ||| |||| |||||  ||||||| ||||||||||||      c
 cccgg  ccc cccg ccucc  gcccugc ucacguuauaac     c
-     -c   -    g     -g       -            cgccc

References

  • microRNA-92b-3p augments colon cancer development through inhibiting KLF3. Liu X, Zhang L. J Biochem Mol Toxicol. 2023 Dec;37(12):e23488.

  • N6-methyladenosine (m6A) methyltransferase WTAP-mediated miR-92b-5p accelerates osteoarthritis progression. Lin Z, Jiang T, Zheng W, Zhang J, Li A, Lu C, Liu W. Cell Commun Signal. 2023 Aug 10;21(1):199.

  • Functional mechanism of miR-92b-3p in osteogenic differentiation of fibroblasts in patients with ankylosing spondylitis via the TOB1/BMP/Smad pathway. Lu L, Sun S, Li H, Xie Y. J Orthop Surg Res. 2023 Jun 2;18(1):402.

  • The miR-20a/miR-92b Profile Is Associated with Circulating γδ T-Cell Perturbations in Mild Psoriasis. Tokić S, JirouÅ¡ M, Plužarić V, Mihalj M, Å ola M, ToluÅ¡ić Levak M, GlavaÅ¡ K, Balogh P, Å tefanić M. Int J Mol Sci. 2023 Feb 21;24(5):4323.

  • Comparative Analysis of microRNAs that Stratify in vitro Mammary stem and Progenitor Activity Reveals Functionality of Human miR-92b-3p. Miller JL, Kanke M, Rauner G, Bakhle KM, Sethupathy P, Van de Walle GR. J Mammary Gland Biol Neoplasia. 2022 Dec;27(3-4):253-269.

  • miR-25 and miR-92b regulate insulin biosynthesis and pancreatic β-cell apoptosis. Shen Z, Yu Y, Yang Y, Xiao X, Sun T, Chang X, Tang W, Zhu Y, Han X. Endocrine. 2022 Jun;76(3):526-535.

  • TGF-β2-induced circ-PRDM5 regulates migration, invasion, and EMT through the miR-92b-3p/COL1A2 pathway in human lens epithelial cells. Huang P, Hu Y, Duan Y. J Mol Histol. 2022 Apr;53(2):309-320.

  • Specificity protein 1/microRNA-92b forms a feedback loop promoting the migration and invasion of head and neck squamous cell carcinoma. Pang P, Fang H, Wu H, Wang S, Liu M, Jin S, Qi Z, Li Z, Liu F, Sun C. Bioengineered. 2021 Dec;12(2):11397-11409.

  • Expression levels and clinical values of miR-92b-3p in breast cancer. Du Y, Miao Z, Wang K, Lv Y, Qiu L, Guo L. World J Surg Oncol. 2021 Aug 11;19(1):239.

  • MicroRNA-92b augments sorafenib resistance in hepatocellular carcinoma via targeting PTEN to activate PI3K/AKT/mTOR signaling. Cheng Z, Ni Q, Qin L, Shi Y. Braz J Med Biol Res. 2021 May 31;54(9):e10390.

  • Potential of peptide-engineered exosomes with overexpressed miR-92b-3p in anti-angiogenic therapy of ovarian cancer. Wang J, Wang C, Li Y, Li M, Zhu T, Shen Z, Wang H, Lv W, Wang X, Cheng X, Xie X. Clin Transl Med. 2021 May;11(5):e425.

  • MicroRNA-92b-3p promotes the progression of liver fibrosis by targeting CREB3L2 through the JAK/STAT signaling pathway. Huang W, Ji R, Ge S, Zhou D, Liu Z, Sun Y, Huang W, Lu C. Pathol Res Pract. 2021 Mar;219:153367.

  • Recognition of nucleolin through interaction with RNA G-quadruplex. Santos T, Miranda A, Campello MPC, Paulo A, Salgado G, Cabrita EJ, Cruz C. Biochem Pharmacol. 2021 Jul;189:114208.

  • Circulating miR-92b and miR-375 for monitoring the chemoresistance and prognosis of small cell lung cancer. Li M, Shan W, Hong B, Zou J, Li H, Han D, Zhang Y, Li L, Li D, Lin W. Sci Rep. 2020 Jul 29;10(1):12705.

  • MicroRNA-92b acts as an oncogene by targeting PTEN/AKT in NSCLC. Guo JH, Fang HY, Yang JM, Liu SL, Yao QH, Fan YJ, Zhao M, Liu F, Zhang QW, Gao FH. Cell Biochem Funct. 2020 Dec;38(8):1100-1110.

  • MiR-92b as a marker for TPF induced chemotherapy response prediction and prognosis evaluation in with advanced oral squamous cell carcinoma patients. Wen J, Xu H, Liu R, Chen Q, Dai Y, Xu Y. Cell Mol Biol (Noisy-le-grand). 2020 Jun 5;66(3):24-31.

  • MiR-92b inhibits proliferation and invasion of lung cancer by targeting EZH2. Chen L, Zhuo HZ, Wu JY, Lin LY, Huang ZL, Lu JX, Cheng KL. Eur Rev Med Pharmacol Sci. 2020 Mar;24(6):3166-3173.

  • MiR-7 reduces the BCSC subset by inhibiting XIST to modulate the miR-92b/Slug/ESA axis and inhibit tumor growth. Li M, Pan M, You C, Zhao F, Wu D, Guo M, Xu H, Shi F, Zheng D, Dou J. Breast Cancer Res. 2020 Mar 6;22(1):26.

  • SEPT9_v2, frequently silenced by promoter hypermethylation, exerts anti-tumor functions through inactivation of Wnt/β-catenin signaling pathway via miR92b-3p/FZD10 in nasopharyngeal carcinoma cells. Jiang Y, Liu L, Xiang Q, He X, Wang Y, Zhou D, Zou C, Chen Q, Peng M, He J, Jiang X, Xiang T, Yang Y. Clin Epigenetics. 2020 Mar 5;12(1):41.

  • Lin28B/miR-92b Promote the Proliferation, Migration, and Invasion in the Pathogenesis of Preeclampsia via the DKK1/Wnt/β-Catenin Pathway. Li N, Huang L, Li Y, Chen X, Yang Y, Hou Y, Qiao C. Reprod Sci. 2020 Mar;27(3):815-822.

    • There are 59 references associated with hsa-miR-92b-5p. Click here to see the complete list in PubMed.