Mature miRNA: hsa-miR-877-5p

Mature miRNA

miRNA Name hsa-miR-877-5p
Previous Name hsa-miR-877
miRNA Sequence 5' - guagaggagauggcgcaggg - 3' (length = 20)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004949

Precursor miRNA

Precursor Name hsa-mir-877
Genomic Location chr6:30584332-30584417 (+); nearby genomic features
NCBI GENE ID 100126314
MIM ID 611619
miRBase ID MI0005561
Precursor Sequence 
-gua      au  c c          g caaagac         c
    gaggag  gg g aggggacacg g       uuggggguu c
    ||||||  || | |||||||||| |       |||||||||  u
    cuccuc  cc c ucuccugugu c       gacucccag g
gacc      --  u u          g ------a         g

References

  • Signal Transducer and Activator of Transcription 4-Induced Up-Regulated LINC01278 Enhances Proliferation and Invasion of Non-Small Cell Lung Cancer Cells via the MicroRNA-877-5p/Activating Transcription Factor 4 Axis. Yang L, Xiao Y, Deng S, Yan D, Li Z, Wang Y, Lei C. Tissue Eng Regen Med. 2024 Jun;21(4):595-608.

  • MicroRNA-877-5p promotes osteoblast differentiation by targeting EIF4G2 expression. Shen Y, Zhang Y, Wang Q, Jiang B, Jiang X, Luo B. J Orthop Surg Res. 2024 Feb 12;19(1):134.

  • Hsa-miR-877-5p Expression in Acute Ischemic Stroke Based on Bioinformatics Analysis and Clinical Validation. Zhang SS, Zhang JW, Zhang KX, Cui WQ, Zhi HW, Li HT, Wu HY, Wang YH. Mol Neurobiol. 2024 Apr;61(4):1990-2005.

  • LncRNA TRG-AS1 inhibits bone metastasis of breast cancer by the miR-877-5p/WISP2 axis. Zhu J, Dai H, Li X, Guo L, Sun X, Zheng Z, Xu C. Pathol Res Pract. 2023 Mar;243:154360.

  • miR-877-3p as a Potential Tumour Suppressor of Oesophageal Squamous Cell Carcinoma. Fukuda T, Baba H, Okumura T, Kanda M, Akashi T, Tanaka H, Miwa T, Watanabe T, Hirano K, Sekine S, Hashimoto I, Shibuya K, Hojo S, Yoshioka I, Matsui K, Kodera Y, Fujii T. Anticancer Res. 2023 Jan;43(1):35-43.

  • miR-877-5p Inhibits Epithelial Mesenchymal Transformation of Breast Cancer Cells by Targeting FGB. Liu H, Xiang L, Mei Y. Dis Markers. 2022 Nov 17;2022:4882375.

  • MicroRNA-877-5p Inhibits Cell Progression by Targeting FOXM1 in Lung Cancer. Liu Z, Wang X, Cao L, Yin X, Zhang Q, Wang L. Can Respir J. 2022 Jun 15;2022:4256172.

  • Integration of bioinformatics analysis and experimental validation identifies plasma exosomal miR-103b/877-5p/29c-5p as diagnostic biomarkers for early lung adenocarcinoma. Wu J, Feng Z, Wang R, Li A, Wang H, He X, Shen Z. Cancer Med. 2022 Dec;11(23):4411-4421.

  • CircCOL5A1 inhibits proliferation, migration, invasion, and extracellular matrix production of keloid fibroblasts by regulating the miR-877-5p/EGR1 axis. Jiao H, Ji G, Luo B, Chen C. Burns. 2023 Feb;49(1):137-148.

  • miR-877-3p inhibits tumor growth and angiogenesis of osteosarcoma through fibroblast growth factor 2 signaling. Chen M, Li Z, Cao L, Fang C, Gao R, Liu C. Bioengineered. 2022 Apr;13(4):8174-8186.

  • microRNA-877-5p exerts tumor-suppressive functions in prostate cancer through repressing transcription of forkhead box M1. Yang B, Diao H, Wang P, Guan F, Liu H. Bioengineered. 2021 Dec;12(1):9094-9102.

  • miRNA-877-5p inhibits malignant progression of prostate cancer by directly targeting SSFA2. Wang W, Yi J, Dong D, Mao W, Wang X, Yan Z. Eur J Histochem. 2021 Sep 20;65(3):3243.

  • Linc00941 regulates esophageal squamous cell carcinoma via functioning as a competing endogenous RNA for miR-877-3p to modulate PMEPA1 expression. Zhang Y, Zhu H, Sun N, Zhang X, Liang G, Zhu J, Xia L, Kou Y, Lu J. Aging (Albany NY). 2021 Jul 13;13(13):17830-17846.

  • Hsa_circ_0042823 accelerates cancer progression Wu T, Sun Y, Sun Z, Li S, Wang W, Yu B, Wang G. Ann Med. 2021 Dec;53(1):960-970.

  • miR-877 inhibits the proliferation, migration, and invasion of osteosarcoma cells by targeting gamma-glutamylcyclotransferase. Jia C, Gao J, Wang L, Li Z, Dong Z, Yao L, Yao X. Endocr J. 2021 Sep 28;68(9):1109-1116.

  • MicroRNA-877-5p alleviates ARDS via enhancing PI3K/Akt path by targeting CDKN1B both in vivo and in vitro. Li K, Huang Z, Tian S, Chen Y, Yuan Y, Yuan J, Zou X, Zhou F. Int Immunopharmacol. 2021 Jun;95:107530.

  • MiR-877 suppresses tumor metastasis via regulating FOXM1 in ovarian cancer. Fang L, Zhang B, Zhu N. J BUON. 2021 Jan-Feb;26(1):229-234.

  • microRNA-877 contributes to decreased non-small cell lung cancer cell growth via the PI3K/AKT pathway by targeting tartrate resistant acid phosphatase 5 activity. Bai X, He C, Fu B, Kong X, Bu J, Zhu K, Zheng W, Zhou F, Ni B. Cell Cycle. 2020 Dec;19(23):3260-3276.

  • Long noncoding RNA DNAH17-AS1 promotes tumorigenesis and metastasis of non-small cell lung cancer via regulating miR-877-5p/CCNA2 pathway. Du LJ, Mao LJ, Jing RJ. Biochem Biophys Res Commun. 2020 Dec 10;533(3):565-572.

  • HOXD-AS1 facilitates cell migration and invasion as an oncogenic lncRNA by competitively binding to miR-877-3p and upregulating FGF2 in human cervical cancer. Chen S, Li K. BMC Cancer. 2020 Sep 25;20(1):924.

    • There are 37 references associated with hsa-miR-877-5p. Click here to see the complete list in PubMed.